Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Determine Pull-ups test for check the body strength?
This test is also done to measure upper body strength or endurance by maximum number of pull-ups completed. Subject hangs from a horizontal bar at a height he can hang from, with arms fully extended and feet free from floor, using an overhand grasp (palms facing away from body). The subject raises body until chin clears the bar and then lowers body to full-hang starting position. As many correct pull-ups as possible are performed.
Define Recommended Intake of Fibre? 1. A minimum of fibre intake of 20 g/day is recommended by the American Dietetic Association (ADA), the National Cancer Institute, US and th
Define Age as a determinants of nutrient requirements? Age: Requirements change with increasing age between birth and maturity. Nutrient requirements per unit body weight are h
lichens
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Triple Vessel Disease (TVD) : Patients with triple vessel disease and impaired left ventricular function do badly on medical treatment. They are candidates for CABG. Operation is
Why are glucorticoids used in transplant patients? Patients with transplanted organs are prone to host versus graft rejection as their own immune system tends to attack the gr
Define classification of carbohydrates - Disaccharides? Disaccharides are condensation products of two monosaccharide units joined together by a linkage called glycosidic linka
Transfer RNA molecules are notable for having generally nucleotides shown in the figure such as 1-methylguanosine (m1G), pseudouridine (Ψ), dihydrouridine (D), inosine (I) and
Amoeboid Tapetum - Tapetum It is also known as invasive or periplus modial tapetum. This type of tapetum is more prevalent in the monocotyledons (Arum) than in the dicotyledon
Organisation of Nervous System Nervous systems are composed of nerve cells or neurons and glial cells. In the latter half of the 19 th century it was strongly believed that
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd