Determine pull-ups test for check the body strength, Biology

Assignment Help:

Determine Pull-ups test for check the body strength?

This test is also done to measure upper body strength or endurance by maximum number of pull-ups completed. Subject hangs from a horizontal bar at a height he can hang from, with arms fully extended and feet free from floor, using an overhand grasp (palms facing away from body). The subject raises body until chin clears the bar and then lowers body to full-hang starting position. As many correct pull-ups as possible are performed.


Related Discussions:- Determine pull-ups test for check the body strength

Define recommended intake of fibre, Define Recommended Intake of Fibre? ...

Define Recommended Intake of Fibre? 1. A minimum of fibre intake of 20 g/day is recommended by the American Dietetic Association (ADA), the National Cancer Institute, US and th

Define age as a determinants of nutrient requirements, Define Age as a dete...

Define Age as a determinants of nutrient requirements? Age: Requirements change with increasing age between birth and maturity. Nutrient requirements per unit body weight are h

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Triple vessel disease , Triple Vessel Disease (TVD) :  Patients with tripl...

Triple Vessel Disease (TVD) :  Patients with triple vessel disease and impaired left ventricular function do badly on medical treatment. They are candidates for CABG. Operation is

Why are glucorticoids used in transplant patients, Why are glucorticoids us...

Why are glucorticoids used in transplant patients? Patients with transplanted organs are prone to host versus graft rejection as their own immune system tends to attack the gr

Define classification of carbohydrates - disaccharides, Define classificati...

Define classification of carbohydrates - Disaccharides? Disaccharides are condensation products of two monosaccharide units joined together by a linkage called glycosidic linka

Modification of trna, Transfer RNA molecules are notable for having general...

Transfer RNA molecules are notable for having generally nucleotides shown in the figure such as 1-methylguanosine (m1G), pseudouridine   (Ψ), dihydrouridine   (D), inosine (I) and

Amoeboid tapetum - tapetum, Amoeboid Tapetum - Tapetum It is also know...

Amoeboid Tapetum - Tapetum It is also known as invasive or periplus modial tapetum. This type of tapetum is more prevalent in the monocotyledons (Arum) than in the dicotyledon

Organisation of nervous system, Organisation of Nervous System Nervou...

Organisation of Nervous System Nervous systems are composed of nerve cells or neurons and glial cells. In the latter half of the 19 th century it was strongly believed that

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd