Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Determine about the Manganese
Manganese performs some functions in photosynthesis and acts to regulate the intake of certain elements and their oxidation states. Several crops have been found to be lower in reducing sugar and sucrose when the Mn2+ supply is limited. Also sugar content from sugarcane is higher where there is ample manganese supply.
An excess of manganese induces chlorosis due to inactivity of iron because of its oxidation by manganese. The deficiency results in a limited development of chlorophyll and as chlorosis. Excess iron brings about symptoms of manganese deficiency. The optimum ratio of Fe/Mn is 2.0 for plant growth.
Name the subcellular particle where the electron transport chain is located. Mitochondria is the subcellular particle where the electron transport chain is located.
could you survive on a diet which contain no carbohydrates
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Show technical aspects of the postero-anterior film? 1) Identification: Patient identification and side marker must be present. 2) Centering: The thoracic spinous pro
Tolerance Range - Ecosystem Organisms are able to survive only within certain maximum and minimum limits with respect to each environmental factor such as water, light and tem
how the structure of ciliates facilitates their parasitism
Lamellar compaction and remodeling (6 to 18 weeks) A remodeling phase is initiated in which hematopoietic-derived osteoclastic cells form cutting cones will remove the establis
Sheep-pox Sheep-pox, a highly contagious disease, causes a mortality of 20 to 50% in animals below the age of 6 months. It also causes damage to the wool and skin in adults. Of
Q. Can you explain about thoracic Aortography? Aortic arch angiography has been used to assess aortic valve or aortic root disease. Thoracic aortography is helpful for assessm
What are the types of digestion and of digestive system of platyhelminthes? Flatworms have incomplete digestive systems and they show intracellular and extracellular complement
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd