Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Determine about the diseases Sleep attacks
These are brief, often irresistible, episodes of sleep, probably slow wave, NREM, naplike sleep that last about 15 minutes and can occur at any time. Their approach is sometimes recognisable, but they can also occur without warning. Episodes are most apt to occur in times of boredom or after meals, but they can also occur during such activities as sexual intercourse, scuba diving, or baseball games. After a brief sleep attack, the affected person may awaken completely alert and remain attack free for a number of hours.
Q. According to their functions how can nutrients are classified? One possible and utile functional classification for nutrients is the one that separates them into energetic,
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. How is carbon dioxide made by producers and consumers? The Carbon dioxide is made by consumers and producers through cellular respiration.
Fallopian tube: There are two fallopian tubes connected to the uterus one on each side of it. The ovum released from the ovarian follicle enters the fallopian tube. Th
Q. Symptoms of chronic gastritis? These include anorexia, chronic fatigue, and feeling of fullness, belching, vague epigastric pain, nausea and vomiting and passage of black ta
List of Conditions Requiring Rapid Treatment of Hypertension 1) Cardiac: • Acute aortic dissection • Acute left ventricular failure • Acute or evolving myocardial i
What is the difference between an ecosystem and a biome?
Explain Methods for Coliform Detection in Water? Sanitary condition of drinking water can be determined by counting the coliform bacteria. It is a reliable and reproducible ind
Foot-rot Foot-rot is a term applied to the condition of feet of cattle, sheep, goats and sometimes pigs. It is characterized by inflammation, necrosis and ulceration of underly
general characteristic of phylum protozoa
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd