Determine about the diseases sleep attacks, Biology

Assignment Help:

Determine about the diseases Sleep attacks

These are brief, often irresistible, episodes of sleep, probably slow wave, NREM, naplike sleep that last about 15 minutes and can occur at any time. Their approach is sometimes recognisable, but they can also occur without warning. Episodes are most apt to occur in times of boredom or after meals, but they can also occur during such activities as sexual intercourse, scuba diving, or baseball games. After a brief sleep attack, the affected person may awaken completely alert and remain attack free for a number of hours.

 


Related Discussions:- Determine about the diseases sleep attacks

How can nutrients are classified, Q. According to their functions how can n...

Q. According to their functions how can nutrients are classified? One possible and utile functional classification for nutrients is the one that separates them into energetic,

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

How is carbon dioxide made by producers and consumers, Q. How is carbon dio...

Q. How is carbon dioxide made by producers and consumers? The Carbon dioxide is made by consumers and producers through cellular respiration.

Fallopian tube, Fallopian tube: There are two fallopian tubes connec...

Fallopian tube: There are two fallopian tubes connected to the uterus one on each side of it. The ovum released from the ovarian follicle enters the fallopian tube. Th

Symptoms of chronic gastritis, Q. Symptoms of chronic gastritis? These ...

Q. Symptoms of chronic gastritis? These include anorexia, chronic fatigue, and feeling of fullness, belching, vague epigastric pain, nausea and vomiting and passage of black ta

Conditions requiring rapid treatment of hypertension, List of Conditions Re...

List of Conditions Requiring Rapid Treatment of Hypertension 1) Cardiac: • Acute aortic dissection • Acute left ventricular failure • Acute or evolving myocardial i

Dissimmilarity between an ecosystem and a biome, What is the difference bet...

What is the difference between an ecosystem and a biome?

Explain methods for coliform detection in water, Explain Methods for Colifo...

Explain Methods for Coliform Detection in Water? Sanitary condition of drinking water can be determined by counting the coliform bacteria. It is a reliable and reproducible ind

Foot-rot, Foot-rot Foot-rot is a term applied to the condition of feet ...

Foot-rot Foot-rot is a term applied to the condition of feet of cattle, sheep, goats and sometimes pigs. It is characterized by inflammation, necrosis and ulceration of underly

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd