Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Determinants of Health StatusThe linkage between economic development and health was discussed in the previous unit. The present unit deals with an identification of the factors which determine the health status of a community. What are the conditions which are most conducive to good health? On the other hand, what are the conditions that are most likely to lead to or perpetuate ill health? These two questions are at the centre of the different issues discussed in this unit. Many factors combined together affect the health of individuals and communities. At a basic or fundamental level, the health status of people in a region or location are determined by their circumstances and environment. This would, in turn, depend upon factors like:
(i) the socio-economic conditions of the people in the area; (ii) Physical environment in terms of their living conditions(iii) Individual characteristics and behaviours (which depend on genetical or inborn factors/traits).
At a more specific level, these determinants (i.e. factors which contribute to making people healthy or its opposite) influence the health status in terms of the following.
Maintenance in the Continuing Care Cycle Impaired dexterity: Any impairment of dexterity, even if it is temporary, may be detrimental to dental implants because home maintena
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
hey what is puperty
Why mosquito bites and it causes itching? A mosquito does not really bite you, of course. It sucks your blood. To help enable effective blood sucking, it firstly injects ant
Implant insertion The technique for insertion of the implant depends largely upon the system being used. In general, the final bone preparation site diameter is slightly smalle
Proteins are very essential macromolecules as they have a range of many important functions like: • Required for building and repair of body tissues (including muscle) • Enzy
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Define Light Source of Microscope? It is either mirror or electric illuminator present at the base. Identify the mirror in Figure. Some microscopes have reversible mirror with
Explain the Ecosystems? The ecosystem is yet another level, or ecological unit, studied by ecologists. An ecosystem encompasses all of the organisms (all the populations-the en
Fluoxetine is an antidepressant drug that presents an action mechanism related to the synaptic transmission. What is that mechanism? Fluoxetine is a substance that inhibits th
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd