Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Describe DNA replication in details?
Replication : DNA replicates itself by first breaking the hydrogen bonds between the nitrogen base pairs, and "unzips" itself into two strands. A replication fork, a Y-shaped structure, moves down the strands as DNA unzips.
Complementary nucleotides, which are floating free in the nucleus, form hydrogen bonds with each separated DNA strand at their matching nucleotide sites according to the base-pairing rule. In this way,
DNA replication is a semi-conservative process whereby each half of the original DNA strand builds a new complementary strand on itself. DNA polymerases catalyze the formation of sugar to phosphate bonds of the nucleotide monomers to complete the building of a new strand on the original strands.
Replication takes place at a very fast rate. In the bacterium E. coli, the complex makes DNA at over 1000 base pairs per second, and makes mistakes in the order of perhaps one base in a billion to one per trillion. In bacteria, there is just one point where replication begins, but in eukaryotes there are many specific origins for replication. Replication can proceed in both directions from an origin.
Define Effect of feeding method on drug availability? The form in which a drug is administered or enters the body can influence its absorption, metabolism or excretion. This be
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is demography? The scientific study of human population is termed as 'Demography'. It focuses attention on three readily observable human phenomena: a) Changes in popul
What is Photosynthesis ? Photosynthesis is the method by which plants trap radiant energy from the sun and convert the energy into a biochemical form. This biochemical energy
Why mosquito bites and it causes itching? A mosquito does not really bite you, of course. It sucks your blood. To help enable effective blood sucking, it firstly injects ant
The major hazards encountered in the biological lab work are diseases like infections and allergies which are caused by handling live animals. dissections, plant and animal tissues
What is the constitutional unit of proteins? The constitutional units of proteins are the amino acids. Protein Structure Review - a) Image Diversity b) amino acid stru
The evolution of human kind can be regarded as the climax of phylogenic history of organisms. In the previous units of this block as well as the previous block we have detailed for
Does the environment exert an influence on the phenotype? A phenotype may be changed (compared to the original situation conditioned by its genotype) by nongenetic means. Examp
1. In cattle, the polled condition (H) is dominant to the horned condition (h). A cross between an individual with red coat (R) and white coat (W) results in roan (RW). A polled, r
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd