Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Casparian strip In plants, the impermeable waxy layer between the cells of endodermis which stops water and solutes from entering into the xylem, except by passing through the cytoplasm of the adjacent cells.
what is it
What are main limitations on size that can be synthesized and how will that be change over next few years? A: Today, a 10kb gene or longer is built as part of the regular produ
Monomeric enzymes Monomeric enzymes are those which consist of only a single polypeptide chain, so they cannot be dissociated into smaller units. Very few monomeric enzymes are
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Water Relations in Terrestrial Environment Insects are the largest group of metazoans which have most successfully invaded the terrestrial environment. In addition, most arach
Q. Precautions should be taken while exercising? Being a diabetic the patient has to take a few precautions. These are: - Initiate the exercise programme gently and then bui
Particulate Theory (i) Maupertuis (1689-1759) proposed that the body of each parent give rise to minute particles. (ii) In sexual reproduction, these particl
Q. Investigation of aortic regurgitation by Electrocardiogram? Electrocardiogram shows left ventricular dominance with voltage criteria for left ventricular hypertrophy. In mod
how do mature sperm differ from those that are not fully developed
In chronic myelogenous leukemia, white blood cells proliferate ceaselessly. In affected white blood cells, the BCR-ABL oncogene, the result of a gene fusion, transmits a constitu
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd