Describe casparian strip, Biology

Assignment Help:

Casparian strip In plants, the impermeable waxy layer between the cells of endodermis which stops water and solutes from entering into the xylem, except by passing through the cytoplasm of the adjacent cells.

82_casparian strip.png


Related Discussions:- Describe casparian strip

What are main limitations on size that can be synthesized, What are main li...

What are main limitations on size that can be synthesized and how will that be change over next few years? A: Today, a 10kb gene or longer is built as part of the regular produ

Explain monomeric enzymes, Monomeric enzymes Monomeric enzymes are thos...

Monomeric enzymes Monomeric enzymes are those which consist of only a single polypeptide chain, so they cannot be dissociated into smaller units. Very few monomeric enzymes are

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Water relations in terrestrial environment, Water Relations in Terrestrial ...

Water Relations in Terrestrial Environment Insects are the largest group of metazoans which have most successfully invaded the terrestrial environment. In addition, most arach

Precautions should be taken while exercising?, Q. Precautions should be tak...

Q. Precautions should be taken while exercising? Being a diabetic the patient has to take a few precautions. These are: - Initiate the exercise programme gently and then bui

Particulate theory - pre-mendelian theory, Particulate Theory (i)      ...

Particulate Theory (i)         Maupertuis (1689-1759) proposed that the body of each parent give rise to minute particles. (ii)         In sexual reproduction, these particl

Investigation of aortic regurgitation by electrocardiogram, Q. Investigatio...

Q. Investigation of aortic regurgitation by Electrocardiogram? Electrocardiogram shows left ventricular dominance with voltage criteria for left ventricular hypertrophy. In mod

Mitoses and meosis, how do mature sperm differ from those that are not full...

how do mature sperm differ from those that are not fully developed

Reciprocal translocation and fusion, In chronic myelogenous leukemia, white...

In chronic myelogenous leukemia, white blood cells proliferate ceaselessly. In affected white blood cells, the BCR-ABL oncogene, the result of a gene fusion, transmits a constitu

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd