Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Derive Gorlin Formula?
Formula I: First Hydraulic Formula (Toricelli's law)
F = AVCc
Where, F = flow rate
A = orifice area
Cc = coefficient of orifice contraction
Rearranging this formula, we get:
A = F / VCc
Wherein A is the orifice area.
DISORDER S OF MALE REPRODUCTIVE SYSTEM (i) Prostatomegaly - Enlargment of prostate gland. It causes difficult & painful micturition. (ii) Impotence - Inability of male
Where does most of the water resorbed after glomerular filtration go? What are the other substances resorbed by the nephron tubules? Only 0.5 to 1% of the glomerular filtrate i
development of chick
What are the forces that make water to flow within the xylem from the roots to the leaves? Water enters the roots because of the root pressure and a water column is maintained
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
what is working of heart
Define the Recommended Dietary Allowance for Vitamin B 12 (RDA)? Vitamin B 12 deficiency is common in true vegans who can be treated with small doses since the daily requirem
Determine the term - Epilepsy In epilepsy, a person suffers from recurrent seizures of various types that register on an electroencephalogram and are associated with disturbanc
What is Nutrition? Explain types of nutrition? Nutrition - Taking Nutrients from environment Nutrients - Substances which are needed for the sources of chemical potential en
Q. Which are the heart chambers respectively where the entrance and the exit of blood occur? The heart chambers through which blood enters the heart are the atria there are the
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd