Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Denitrification - Nutrient Cycles
Nitrates are readily leached from the soil and also lost through denitrification the process by which molecular or gaseous nitrogen (N2) as well as nitrous oxide (NO) 'and nitric oxide (N2O) and nitrogen dioxide (NO2) are formed from NO-3 by bacteria (such as pseudomonas) and fungi. They use the nitrate as a source of oxygen in the presence of glucose and phosphate. Denitrifing bacteria prefer anaerobic or partially aerobic habitats such as estuaries, bogs, lake bottoms and water-logged soils. The bacteria reduce the nitrates to nitrites which are finally converted to free nitrogen.
Explain Viscosity of Gastrointestinal Contents Delay Absorption? 1. Inadequate mixing of luminal contents due to increased viscosity may slow the movement of digestive enzymes
What is polyembryony? Polyembryony is the phenomenon in which a single embryo in its initial embryonic stage separates itself forming many new individuals of the similar sex an
Plant Responses to Light-Dark Cycles Based on their requirement for day length (number of hours of light) for flowering plants have been grouped under three major categories,
STIMULENT S - It makes a person more wakeful, alert and active. (i) Caffeine ( C 8 H 10 N 4 O 2 ) - It is 1,3,7-trimethylxanthine obtained from tea leaves ( Thea si
Explain brifly what is Genetic Engineering ? Genetic Engineering : Engineering techniques have been used in agriculture and horticulture for centuries. Certain plants or ani
What is the etiological agent of visceral leishmaniasis? How is the disease transmitted and what are its typical manifestations? Visceral leishmaniasis is caused by the protozo
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What do you mean by Acute Pericarditis? Ans. Acute pericarditis is defined as acute inflammation of the pericardium and is clinically characterized by chest pain, fever, t
Behavioural Adjustments When faced with a sudden temperature change, most animals make behavioural responses that enable them to avoid extreme or lethal conditions. Among the
What does Liquescence digestive enzyme do? It helps to normalize the secretion of digestive juices and enzymes in the gastrointestinal tract
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd