Define various methods of food processing, Biology

Assignment Help:

Define Various Methods of Food Processing?

In this unit, you studied the various methods of food processing. You learnt that food being most vital for the survival of human beings must be processed using scientific techniques. In this context, you learnt in a great detail about thermal processing i.e., cooking, blanching, pasteurization, sterilization and canning; dehydration and various drying techniques. Another aspect which was considered in this unit was the preservation by means of concentration. In this, the main focus was on the various methods of concentration and the changes that occur in food as a result of concentration.


Related Discussions:- Define various methods of food processing

Consequences on the bony structures, Q. Consequences on the bony structures...

Q. Consequences on the bony structures? Basal bone forms the dental skeletal structure. Wolff's law states that the bone remodels in relationship to the forces applied. With a

How does the male gamete penetrate the egg cell, Q. How does the male gamet...

Q. How does the male gamete penetrate the egg cell? How does the female gamete protect itself from the entrance of more gametes after the entrance of the first sperm cell? The

Coronary arteries, Coronary Arteries The right coronary artery origina...

Coronary Arteries The right coronary artery originates form the right aortic valvular cusp, its, SA nodal branch supplies the SA node and AV nodal branch supply the AV nod

Types of environmental pollution, There are several kinds of pollution, mai...

There are several kinds of pollution, main among them are as follows:

Oxusome, structure of oxysome

structure of oxysome

Aschelminthes, In what part of the human body ASchelminthes found?

In what part of the human body ASchelminthes found?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Salivary analyse works on foods, Explain how salivary amylase works on food...

Explain how salivary amylase works on foods like crackers

Type of fecundation that occur in arthropods, Q. What are the kinds of fecu...

Q. What are the kinds of fecundation that occur in arthropods? What is the predominant kind? In arthropods there are species having exterior fecundation and other species havin

What are biogeochemical cycles, Q. What are biogeochemical cycles? The ...

Q. What are biogeochemical cycles? The Biogeochemical cycles are representations of the circulation and recycling of matter in nature. The major biogeochemical cycles studie

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd