Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define the Primary Stain and Mordant?
(i) Primary Stain - Crystal violet is the primary or first stain, which stains all the cells violet/purple.
(ii) Mordant - Gram's iodine serves as mordant. It binds with primary stain to form insoluble complex, crystal violet-iodine (CV-I) complex, that intensify the colour of the stain. At this point, all cells will appear purple - black.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What are the difference between plasma membrane and cell wall? Plasma membrane and cell wall is not the same thing. Plasma membrane, also known as cell membrane, is the exte
Three ways in which food might become contaminated by harmful bacteria. Food may become contaminated:- (i) from the unwashed hands of a food-handler, (ii) by house- flies
A female frog has a genetic trait that stops it from producing eggs. How likely is it that this trait will spread by the frog population? Explain your answer. This trait will
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
What was the case of Phineas Gage Some Procedures are not used experimentally on humans, but sometimes brain tissue is ablated for medical reasons such as the excision of tumo
The fishes belong to class Pisces under vertebrates. 2. In fishes, the respiratory system consists of mouth, pharynx, internal branchial apertures, branchial pouches and external b
Locomotion Continuous formation of new pseudopodia keeps amoeba in constant locomotion .This is called amoeboid movement .It occurs in many other protozoans , in amoebo
Diesel-like liquid obtained from materials of biological origin is called biodiesel. Biodiesel can be obtained (i) either from lipids accumulated plants and algae or (ii) from
Explain the relationship between an agonist muscle and its antagonist as it relates to positional control, functional movement and neuromuscular activation. For example, how the tw
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd