Define the primary stain and mordant, Biology

Assignment Help:

Define the Primary Stain and Mordant?

(i) Primary Stain - Crystal violet is the primary or first stain, which stains all the cells violet/purple.

(ii) Mordant - Gram's iodine serves as mordant.  It binds with primary stain to form insoluble complex, crystal violet-iodine (CV-I) complex, that intensify the colour of the stain.  At this point, all cells will appear purple - black.


Related Discussions:- Define the primary stain and mordant

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What are the difference between plasma membrane, Q. What are the difference...

Q. What are the difference between plasma membrane and cell wall? Plasma membrane and cell wall is not the same thing. Plasma membrane, also known as cell membrane, is the exte

Food might become contaminated by harmful bacteria, Three ways in which foo...

Three ways in which food might become contaminated by harmful bacteria. Food may become contaminated:- (i) from the unwashed hands of a food-handler, (ii) by house- flies

Why a female frog has a genetic trait, A female frog has a genetic trait th...

A female frog has a genetic trait that stops it from producing eggs. How likely is it that this trait will spread by the frog population? Explain your answer. This trait will

Ammonotelism - excretion, Normal 0 false false false EN...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

What was the case of phineas gage, What was the case of Phineas Gage S...

What was the case of Phineas Gage Some Procedures are not used experimentally on humans, but sometimes brain tissue is ablated for medical reasons such as the excision of tumo

Respiratory system in fishes, The fishes belong to class Pisces under verte...

The fishes belong to class Pisces under vertebrates. 2. In fishes, the respiratory system consists of mouth, pharynx, internal branchial apertures, branchial pouches and external b

Locomotion in amoeba, Locomotion Continuous formation of new  pseudopod...

Locomotion Continuous formation of new  pseudopodia keeps amoeba in constant locomotion .This is called  amoeboid  movement .It  occurs  in many  other  protozoans , in  amoebo

Biodiesal, Diesel-like liquid obtained from materials of biological origin ...

Diesel-like liquid obtained from materials of biological origin is called biodiesel. Biodiesel can be obtained (i) either from lipids accumulated plants and algae or (ii) from

Define activation of the antagonist during movement, Explain the relationsh...

Explain the relationship between an agonist muscle and its antagonist as it relates to positional control, functional movement and neuromuscular activation. For example, how the tw

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd