Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define the Phosphorus - The Macromineral?
The body contains about 620 g (20 moles) of phosphorus. Of this 87% is present in bones. It is thus more widely distributed in the body than calcium as part of it is also found in soft tissues. Phosphorus is present in nucleic acids and is also present in some proteins, lipids and enzymes. It is essential in storage and liberation of energy and in the intermediate metabolism of carbohydrates and lipids.
Nutrition
Q. Value of biodiversity? Today, there is widespread concern for conservation of wild animals and plants. One might wonder why there is so much concern about protecting other s
Systolic heart failure is a classic heart failure where the inotropic (contractile) state is impaired and the expulsion of blood is not adequate. So the main manifestations of syst
Osteogenesis: Production of Bone on Soft Tissue Now that we know the players in bone adaptation, we will look at the ways in which bone may be created and modified. There are t
what is r and k selection
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Ribosomes - It is also known as Protein factory, Engine of the cell. Ribosomes are smallest cell organelles (150 x 250 Å). Unit membrane less cell organelle. Ribo
Q. Can you explain Ventricular Tachycardia? The term is usually reserved for at least four or more beats and modified by the term non sustained. Short runs of non-sustained VT
Explain the DNA Hybridisation? This technique is used to study or compare the genetic affinity between two organism. In such studies the deoxyribonucleic acid (DNA) of both org
ASSISTING IN PROCEDURE OF BIOPSY Biopsies are removal of a small piece of tissue for examination under microscope. Such examinations are called hist to pathological examina
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd