Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define the LTLT Pasteurization Method?
In LTLT pasteurization, the pasteurization time is in the order of minutes and related to the temperature used; two typical temperature/time combinations are used: 63 to 65°C over 30 minutes or 75° C over 8 to 10 minutes.
In this first class of pasteurization processes it is probable to define three phases:
a) Heating to a fixed temperature;
b) Keeping this temperature over the established time period (= pasteurization time);
c) Cooling the pasteurized products: natural (slow) or forced cooling.
You would notice that, pasteurization temperature and time will vary according to:
a) Nature of product; initial degree of contamination;
b) Pasteurized product storage conditions and shelf life required.
Define Lipids - Tests for Presence of Exoenzymatic Activity? Lipids are also high molecular weight compounds. Enzyme lipases (esterases) cleaves the ester bond to form glycerol
Mineral supplements There are two major classes of mineral sources: inorganic and organic. Organic complexes, however, have been shown to be more effectively absorbed by the a
Can stroke be prevented Brain experts are convinced that several strokes can be prevented with proper attention to lifestyle factors which increase risk, including smoking, exc
Heat-shock Response When growing plantlets or tissues of plants are shifted to 42°C and above, the synthesis of normal proteins rapidly declines and instead a set of new prote
In genetic recombination by crossing over what is the difference between parental gametes and recombinant gametes? Parental gametes are those gametes that keep the original lin
Describe how electro negativity can explain why a C-H bond is a no polar covalent bond, but a O-H bond is a polar covalent bond.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Use of Sulphur dioxide and sulphites in microorganisms? Sulphur dioxide as a preservative in wine preparation has been in use since ancient times. It is also used in other f
Neurological Assessment The neurological assessment is made up of eight neurological criteria which have high, significance with gestational age. (Fig. 3.2) In order to perf
Q. How does the depolarization of the neuronal membrane start? The primary cause of the neuronal depolarization is the binding of neurotransmitters released in the synapse by t
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd