Define the ltlt pasteurization method, Biology

Assignment Help:

Define the LTLT Pasteurization Method?

In LTLT pasteurization, the pasteurization time is in the order of minutes and related to the temperature used; two typical temperature/time combinations are used: 63 to 65°C over 30 minutes or 75° C over 8 to 10 minutes.

In this first class of pasteurization processes it is probable to define three phases:

a) Heating to a fixed temperature; 

b) Keeping this temperature over the established time period (= pasteurization time); 

c) Cooling the pasteurized products: natural (slow) or forced cooling. 

You would notice that, pasteurization temperature and time will vary according to:

a) Nature of product; initial degree of contamination; 

b) Pasteurized product storage conditions and shelf life required.


Related Discussions:- Define the ltlt pasteurization method

Skeleton, biological significant of a skeleton

biological significant of a skeleton

Nervous system control of blood pressure, Q. Nervous System control of bloo...

Q. Nervous System control of blood pressure? Most nervous controls are achieved via involuntary reflex arcs involving pressoreceptors, the vasomotor centers of the medulla, and

Binomial nomenclature, collection of different animals,human being and inse...

collection of different animals,human being and insects stages of binomial nomenclature

What is physiology root pressure explain briiefly, What is Physiology: Root...

What is Physiology: Root Pressure explain briiefly? Transport of water, minerals and nutrients within vascular plants is dramatically different from animals such as humans. Whe

Our healthi diet, in what form is most carbohydrates is taken in normal die...

in what form is most carbohydrates is taken in normal diet

What are the male and the female gonads in humans, Q. What are gonads? What...

Q. What are gonads? What are the male and the female gonads in humans? Gonads are the organs that produce gametes they contain the germ cells that undergo division and generate

Phylogenetic systems of classification, Q. Phylogenetic systems of classifi...

Q. Phylogenetic systems of classification? As already pointed out 'earlier that in Phylogenetic system, the plants are classified according to their evolutionary relationships.

Male reproductive disorders-absence of vesicular glands, Absence of vesicul...

Absence of vesicular glands In some bulls the vesicular glands are either absent or hypoplastic also sometimes accompanied by poorly developed ampullae. A characteristic sympt

What is pollination, What is pollination? What are the main forms of pollin...

What is pollination? What are the main forms of pollination? The process in which pollen grains (the male gametophytes of phanerogamic plants) reach the female gametophyte is k

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd