Define the intracellular cyclic amp, Biology

Assignment Help:

Define the intracellular cyclic AMP

Healthy Person P takes a drug that makes a strong effect on the epithelial cells of the kidney collecting duct within one hour and lasts for one week after taking the drug.  One day after taking the drug, which of the following will create a condition with the symptoms of diabetes insipidus in Healthy Person P?

A. Drug X that blocks endocytosis of AQP2 for one week.

B. Drug Y that results in continuous very high levels of intracellular cyclic AMP (cAMP) for one week.

C. Drug Z is an antagonist at V2 receptors that remains bound to V2 receptors for one week.

 


Related Discussions:- Define the intracellular cyclic amp

Define use of soy protein concentrates in bakery products, Define Use of So...

Define Use of Soy Protein Concentrates in Bakery Products? Unlesss higher protein fortification levels are necessary, there is no special reason for using soy protein concentra

Gastropods - feeding and digestion in molluscs, Gastropods - Feeding and Di...

Gastropods - Feeding and Digestion in Molluscs In several gastropods the digestion is extracellular. Though, some herbivore gastropods like Crepidula are ciliary feeders and h

, comparitive table to explain the differences between the animals in chor...

comparitive table to explain the differences between the animals in chordate classes

Source of cells for regeneration, Source of Cells for Regeneration It...

Source of Cells for Regeneration It had been considered earlier that interstitial cells constitute a reserve of undifferentiated cells that provide the cellular material for

Botany, how can i earn money by submitting assignments?

how can i earn money by submitting assignments?

Homeostasis , Homeostasis Homeostasis may be defined as the maintenan...

Homeostasis Homeostasis may be defined as the maintenance of constancy in the internal environment of the organism. This is essential for maintenance of life. Without homeost

Determine major aspects of the mechanism of freeze drying, Determine Major ...

Determine Major Aspects of the Mechanism of Freeze Drying? The major aspects of the mechanism of freeze drying are:  (a) The removal of vapour from the subliming ice front w

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What are the main intraspecific ecological interactions, Q. What are the ma...

Q. What are the main intraspecific ecological interactions? The major harmonious intraspecific ecological interactions are societies and colonies. The major inharmonious intras

Distribution coefficient -terminology used in chromatography, Distribution ...

Distribution Coefficient - Terminologies used in Chromatography? During the purification or separation of the biomolecules it should be kept in mind that two important factors

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd