Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define the intracellular cyclic AMP
Healthy Person P takes a drug that makes a strong effect on the epithelial cells of the kidney collecting duct within one hour and lasts for one week after taking the drug. One day after taking the drug, which of the following will create a condition with the symptoms of diabetes insipidus in Healthy Person P?
A. Drug X that blocks endocytosis of AQP2 for one week.
B. Drug Y that results in continuous very high levels of intracellular cyclic AMP (cAMP) for one week.
C. Drug Z is an antagonist at V2 receptors that remains bound to V2 receptors for one week.
Define Use of Soy Protein Concentrates in Bakery Products? Unlesss higher protein fortification levels are necessary, there is no special reason for using soy protein concentra
Gastropods - Feeding and Digestion in Molluscs In several gastropods the digestion is extracellular. Though, some herbivore gastropods like Crepidula are ciliary feeders and h
comparitive table to explain the differences between the animals in chordate classes
Source of Cells for Regeneration It had been considered earlier that interstitial cells constitute a reserve of undifferentiated cells that provide the cellular material for
how can i earn money by submitting assignments?
Homeostasis Homeostasis may be defined as the maintenance of constancy in the internal environment of the organism. This is essential for maintenance of life. Without homeost
Determine Major Aspects of the Mechanism of Freeze Drying? The major aspects of the mechanism of freeze drying are: (a) The removal of vapour from the subliming ice front w
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What are the main intraspecific ecological interactions? The major harmonious intraspecific ecological interactions are societies and colonies. The major inharmonious intras
Distribution Coefficient - Terminologies used in Chromatography? During the purification or separation of the biomolecules it should be kept in mind that two important factors
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd