Define the indications for root-end resection apicoectomy, Biology

Assignment Help:

Define the Indications for Root-End Resection Apicoectomy

a) Persistent..... "Exactly the SAME of Curettage except the biopsy.

b) When the apical portion of the root canal system of a tooth with periapical pathosis cannot be cleaned, shaped, or obturated.


Related Discussions:- Define the indications for root-end resection apicoectomy

Define role of public nutritionist in health care delivery, Define the Role...

Define the Role of Public Nutritionist in Health Care Delivery? It is clearly evident from the foregoing discussion that nutrition is an important, though not the only, determi

Define vapour pressure - properties of solutions, Vapour Pressure The i...

Vapour Pressure The intermolecular forces in a liquid prevent most molecules from escaping from the surface. However, due to molecular collisions, some molecules have sufficien

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

How can the abundance and diversity of living beings, How can the abundance...

How can the abundance and diversity of living beings in the tropical forests be explained? The biodiversity of these ecosystems can be defined by the great availability of the

Complete the diagram by dragging the correct label, For the cross in Part B...

For the cross in Part B, predict the frequencies of each of the phenotypes in the F1 progeny, and determine the genotype(s) present in each phenotypic class. Complete the diagram b

Define harvard step test - aerobic capacity, Define Harvard Step Test - aer...

Define Harvard Step Test - aerobic capacity? In this test, the subject steps on and off an 18-inch platform at a rate of 30 times per minute. The evaluator records the subject'

Poultry and duck diseases-ranikhet disease, Ranikhet disease Ranikhet ...

Ranikhet disease Ranikhet disease, also known in the west as Newcastle disease, is a contagious and highly fatal disease of fowls caused by a virus of the genus Rubulavirus in

Mulluscas., economic importance of mulluscas

economic importance of mulluscas

Placenta, PLACENTA - A common tissue of foetus & mother (uterus) which ...

PLACENTA - A common tissue of foetus & mother (uterus) which is physical, physiological & endocrinal connection is known as placenta. FUNCTIO N - To provide nutrients

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd