Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define the General Mortality and Morbidity Risk?
Obesity increases the risk of morbidity and mortality. The obese are more prone to developing morbidities or other chronic diseases like, cardiovascular disease including hypertension and dyslipidaemia, non-insulin dependent diabetes mellitus, gall bladder disease and gout. The risk of developing some non-fatal conditions like arthritis, back pain, infertility, sleep disorders and other respiratory conditions leads to increased morbidity among the obese. Let's discuss these conditions in slightly more detail.
Explain Adverse effects of Indinavir In addition to adverse effects similar to those of other protease inhibitors, indinavir causes elevation of indirect bilirubin, indinavir
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define the effect of niacin deficiency on Skin? Dermatitis is the characteristic feature of the' disease, It is symmetrical in distribution. In early stages, a bright red eryt
Conjugation – Protozoan Conjugation is characteristic of ciliates. The details vary from species to species. The general features can be observed in Paramecium sps. which has
Based on your reading of the article "The Inner Life of the Genome" which of the following is a wrong statement regarding the organization of chromosomes within the nucleus? A.
When ATP gives energy to the cellular metabolism it loses one of its phosphates and ADP reappears. ADP can also lose more phosphates and produce AMP (adenosine monophosphate) o
Q. Why can be the consumption of molecular oxygen indicates the metabolic rate of aerobic organisms? Molecular oxygen (O 2 ) consumption has direct relation to the cell metabol
Q. Despite having a great biodiversity why is the Amazon Rainforest under risk of desertification? The natural soil of the Amazon Rainforest isn't very fertile but it is enrich
Q. Briefly explain about Type Specimens ? The specimens on which the names of the species are based are kept as type specimens. Do not replace these specimens because these wi
How to draw diagrams of bones
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd