Define the general mortality and morbidity risk, Biology

Assignment Help:

Define the General Mortality and Morbidity Risk?

Obesity increases the risk of morbidity and mortality. The obese are more prone to developing morbidities or other chronic diseases like, cardiovascular disease including hypertension and dyslipidaemia, non-insulin dependent diabetes mellitus, gall bladder disease and gout. The risk of developing some non-fatal conditions like arthritis, back pain, infertility, sleep disorders and other respiratory conditions leads to increased morbidity among the obese. Let's discuss these conditions in slightly more detail.


Related Discussions:- Define the general mortality and morbidity risk

Explain adverse effects of indinavir, Explain Adverse effects of Indinavir ...

Explain Adverse effects of Indinavir   In addition to adverse effects similar to those of other protease inhibitors, indinavir causes elevation of indirect bilirubin, indinavir

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define the effect of niacin deficiency on skin, Define the effect of niacin...

Define the effect of niacin deficiency on Skin? Dermatitis is the characteristic feature of the' disease, It is symmetrical in distribution. In early stages, a bright red eryt

Conjugation – protozoan, Conjugation – Protozoan Conjugation is charac...

Conjugation – Protozoan Conjugation is characteristic of ciliates. The details vary from species to species. The general features can be observed in Paramecium sps. which has

Define the term - the inner life of the genome, Based on your reading of th...

Based on your reading of the article "The Inner Life of the Genome" which of the following is a wrong statement regarding the organization of chromosomes within the nucleus? A.

When atp gives energy to the cellular metabolism, When ATP gives energy to ...

When ATP gives energy to the cellular metabolism it loses one of its phosphates and ADP reappears. ADP can also lose more phosphates and produce AMP (adenosine monophosphate) o

Show metabolic rate of aerobic organisms, Q. Why can be the consumption of ...

Q. Why can be the consumption of molecular oxygen indicates the metabolic rate of aerobic organisms? Molecular oxygen (O 2 ) consumption has direct relation to the cell metabol

Why is the amazon rainforest under risk of desertification, Q. Despite havi...

Q. Despite having a great biodiversity why is the Amazon Rainforest under risk of desertification? The natural soil of the Amazon Rainforest isn't very fertile but it is enrich

Briefly explain about type specimens, Q. Briefly explain about Type Specime...

Q. Briefly explain about Type Specimens ? The specimens on which the names of the species are based are kept as type specimens. Do not replace these specimens because these wi

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd