Define the characteristics that are seen in rickets, Biology

Assignment Help:

Define the characteristics that are seen in Rickets?

The following characteristics are seen in fully developed cases of rickets:

1) In case of young infants, delayed closure of the fontanelles i.e. a soft membranous gap between the cranial bones, softening and reduced mineralization of the skull (craniotabes).

2) While in older infants, sitting and crawling are delayed and there is bossing of skull. Also there are soft, fragile bones, bow legs, enlargement of the costochondral junction (a cartilage that attaches the front of the ribs to the breastbone) with rows of knobs or beads forming the Rachitic Rosary, pigeon chest and spinal curvature.

3) Enlargement of wrist, knee (knock-knees) and ankle joints.

4) Poorly developed muscles, lack of muscle tone, pot belly being the result of weakness of abdominal muscles, weakness with delayed walking.

5) Restlessness and nervous irritability.

6) High serum alkaline phosphatase, low inorganic blood phosphorus, normal or low serum calcium.

7) Tetany characterized by low serum calcium, muscle twitching, cramps and convulsions.

8) Delayed dentition and malformation of the teeth, permanent teeth more' subject to decay.


Related Discussions:- Define the characteristics that are seen in rickets

Define standardization - nutritional biochemistry, Define Standardization ...

Define Standardization - Nutritional  Biochemistry? One of the substances involved in a titration must be used as a standard for which the amount of substance present is accura

How do biodiversity vary during the ecological succession, Q. How do biodiv...

Q. How do biodiversity, the total number of living beings and the biomass respectively vary during the ecological succession? The Biodiversity, the biomass of an ecosystem and

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

State about heller nitric acid test, State about Heller's Nitric Acid Test ...

State about Heller's Nitric Acid Test Take 1 ml concentrated (fuming) nitric acid in a test tube and add 2 ml of urine by means of a pipette by the side of the test tube and la

What do you mean by herbaria and museums, Q. What do you mean by Herbaria a...

Q. What do you mean by Herbaria and Museums? A herbarium is a collection of pressed and dried plants arranged according to some valid system of classification and available for

Excretory system, extensive note on the excretory system of amphibian

extensive note on the excretory system of amphibian

How the brain influences or controls immune system, How the brain influence...

How the brain influences or controls immune system Scientists are still working to determine to what degree, and how, the brain influences or controls immune system functions,

Explain the fistulative surgery - endodontic surgery, Explain the Fistulati...

Explain the Fistulative surgery - Endodontic Surgery = (Incision and drainage) 1 Cortical trephination 2 Decompression 3

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd