Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define the Armamentarium
a) Micro-mirrors (magnification: x 40, Size: 0.5)
b) Micro-probe
c) Micro-blades, tissue retractors
d) Burs
e) Retrograde Tips "round bur "
f) Methyline - blue: to detect the canals "as MM canal".
Q. Complications in celiac disease? Patients with severe form of celiac's disease for long period are at risk for several complications mainly due to nutrient absorption probl
is mismatch repair something different from proofreading?
It is elimination of an antigen or antibody from a sample by the process of adsorption, to which the complimentary antigen or antibody is bound.
Define Root-End Resection Apicoectomy a. Examine the root surface before cutting for: cracks, anatomical variations, and quality of orthograde obturation. b. Cut the root en
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
P n e u mo n i a It is inflammation of pulmonary parenchyma, usually accompanied by inflammation of bronchioles, and is characterized by cough, increased respiratory rat
Q. What is the DNA vaccine? The DNA vaccination or is a vaccination technology based on genetic engineering. In DNA vaccine a recombinant plasmid (vector) containing the gene o
Causes of Air Pollution We known about the composition of atmosphere, its major and minor constituents. The composition of atmosphere has remained the same for thousands of y
How is the gastric mucosa protected from the acid pH of the stomach? The gastric epithelium is mucus secretory, i.e., it makes mucus. The mucus covers the stomach wall preventi
Various ways/techniques suggested for control of water pollution are as follows: 1. Pollutants (radio active, chemical, biological) present in water bodies can be removed by app
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd