Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define the Absorption of Vitamin A?
Vitamin A and carotenoid tend to aggregate with lipids into globules, which then pass into the small intestine. Dietary vitamin A (retinol) is absorbed as such in the intestines. Retinyl esters (mainly palmitate) arc hydrolyzed by the combined action bile salts and the esterases in the small intestine. The released carotenoids and retino1 in the small intestine are solubilised into micelles i.e., small aggregates of mixed lipids and bile salts suspended within the gastric bolus (material taken into the body by way of. The digestive tract)solution. The micelles are absorbed into the intestinal mucosal cell. Approximately 70 to 90% of retinol from the diet is absorbed as long as the diet is adequate in fat. Carotenoid absorption from the diet ranges from about 20% to 50%, but carotenoid absorption may be as low as 5%.
Explain lipids? Lipids : Lipids function as energy-storing molecules such as fats and oils, protective waxes, digestive tract lubricants, heat insulation such as whale blubber
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Fate Maps The details of the procedure of gastrulation are not simple to understand without the knowledge of positions of the cells of the future germinal layers in the blast
Define Termination phase - mechanism of protein synthesis? Termination: RNA polymerase recognizes the terminator, which results in no further nucleotides being incorporated and
Define Nutrition Counseling - Management of Eating Disorders? Nutrition counseling can be used to accomplish a variety of goals, such as reducing behaviours related to the eati
Question Write a short note on the following 1 Stem cells 2 Edible vaccines 3 Biologic Materials 4 Liposomes 5 What are gene chips? Explain any 4 applications of g
Functional Domains in Children There are three functional domains of particular interest in this age range: Attention, Memory, and Executive function. The
Seed Dormancy - Plant Growth Substances Seed dormancy is critically important for the survival of plants. Factors involved in seed dormancy are: A. Environmental Factors
Counselling a diabetic patient and their family members is very important as patient has to modify the life style and diet and needs family support. Therefore it is important for y
Enumerate about the Baule unit A mathematician from Gottingen by the name of B. Baule assisted Mitscherlich with his calculations. The quantity of any growth factor (nutrient
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd