Define the absorption of vitamin a, Biology

Assignment Help:

Define the Absorption of Vitamin A?

Vitamin A and carotenoid tend to aggregate with lipids into globules, which then pass into the small intestine. Dietary vitamin A (retinol) is absorbed as such in the intestines.  Retinyl esters (mainly palmitate) arc hydrolyzed by the combined action bile  salts and the esterases in the small intestine. The released carotenoids and retino1 in the small intestine are solubilised into micelles i.e., small aggregates of mixed lipids and bile salts suspended within the gastric bolus (material taken into the body by way of.  The digestive tract)solution. The micelles are absorbed into the intestinal mucosal cell.  Approximately 70 to 90% of retinol from the diet is absorbed as long as the diet is adequate in fat. Carotenoid absorption from the diet ranges from about 20% to 50%, but carotenoid absorption may be as low as 5%.


Related Discussions:- Define the absorption of vitamin a

Explain lipids, Explain lipids? Lipids : Lipids function as energy-sto...

Explain lipids? Lipids : Lipids function as energy-storing molecules such as fats and oils, protective waxes, digestive tract lubricants, heat insulation such as whale blubber

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Fate maps, Fate Maps The details of the procedure of gastrulation are...

Fate Maps The details of the procedure of gastrulation are not simple to understand without the knowledge of positions of the cells of the future germinal layers in the blast

Define termination phase - mechanism of protein synthesis, Define Terminati...

Define Termination phase - mechanism of protein synthesis? Termination: RNA polymerase recognizes the terminator, which results in no further nucleotides being incorporated and

Define nutrition counseling - management of eating disorders, Define Nutrit...

Define Nutrition Counseling - Management of Eating Disorders? Nutrition counseling can be used to accomplish a variety of goals, such as reducing behaviours related to the eati

What are gene chips, Question  Write a short note on the following 1 St...

Question  Write a short note on the following 1 Stem cells 2 Edible vaccines 3 Biologic Materials 4 Liposomes 5 What are gene chips? Explain any 4 applications of g

State the functional domains in children, Functional Domains in Children ...

Functional Domains in Children There are three functional domains of particular interest in this age range: Attention, Memory, and Executive function. The

Seed dormancy - plant growth substances, Seed Dormancy - Plant Growth Subst...

Seed Dormancy - Plant Growth Substances Seed dormancy is critically important for the survival of plants. Factors involved in seed dormancy are: A. Environmental Factors

Counselling technique of diabetic patient, Counselling a diabetic patient a...

Counselling a diabetic patient and their family members is very important as patient has to modify the life style and diet and needs family support. Therefore it is important for y

Enumerate about the baule unit, Enumerate about the Baule unit  A mathe...

Enumerate about the Baule unit  A mathematician from Gottingen by the name of B. Baule assisted Mitscherlich with his calculations.  The quantity of any growth factor (nutrient

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd