Define systematic botany - taxonomy, Biology

Assignment Help:

Define Systematic Botany - Taxonomy?

We will now learn something mare about systematic botany. The early recognition of harmful and useful plants was the beginning of systematic botany. When the language was developed it was possible that observation of plants was accumulated and this knowledge could be passed from one generation to the next. Today, the basic recognition and grouping of plants has developed into a highly complex science concerned with classifying plants into groups based on postulated evolutionary relationships. Systematic botany includes all activities that are part of the effort to organise and record the diversity of plants and acquaints us with the fascinating differences among the species of plants. Thus systematic provide an inventory of plants or animals, scheme of identification, their names and a system of classification.

Systematic is basic to other scientific fields, but also it depends on other disciplines for information and data useful in constructing classifications. A sound classification bringing related organisms together, may suggest problems worthy of study by ecologists, plant breeders, pharmacologists, horticulturists and biochemists.

 


Related Discussions:- Define systematic botany - taxonomy

What is meant by gene expression, What is meant by Gene Expression? The...

What is meant by Gene Expression? The synthesis of protein under the influence of gene is called Gene Expression. All human cells are derived from a single cell, fertilized egg

Reasons for growth of population, REASON S FOR GROWTH OF POPULATION - ...

REASON S FOR GROWTH OF POPULATION - The human population explosion is mainly a result of reduced death rate. Main reasons for it are - 1 .       Protection from natura

Maintenance and regulation of peripheral circulation, Maintenance and Regul...

Maintenance and Regulation of Peripheral Circulation Pressure receptors (baroreceptors) located in the wall of the internal carotid arteries and in the arch of aorta, when

Explain the transcription and the replication processes, What are similarit...

What are similarities and differences among the transcription process and the replication processes? A DNA polynucleotide chain serves as a template in replication (DNA duplica

What are trophic levels, What are trophic levels? How many trophic levels c...

What are trophic levels? How many trophic levels can a food chain have? The Trophic levels correspond to positions on a food chain. thus producers always belong to the first tr

What is biological control, What is biological control? Biological cont...

What is biological control? Biological control is a natural process to control the size of animal, microorganism or plant populations. Biological control is based on the knowle

Give an example of structural protein, Give an example of each of the follo...

Give an example of each of the following types of proteins: a. Enzyme b. Structural protein c. Motor protein

Explain the activity of decomposers, Why are producers the first trophic le...

Why are producers the first trophic level to advantage from the activity of decomposers? Decomposers return nutrients in dead tissues and wastes to the soil or water; producers

Determine the major foot problem in diabetic patient, Determine the major f...

Determine the major foot problem in diabetic patient The American Diabetic Association (ADA) has estimated that 50% of the limbs with foot ulcers can be saved if both the heal

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd