Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define Serum Vitamin A Content?
Assessment of serum vitamin A content is the most reliable criterion Tor assessing vitamin A status. Serum levels indicative of various degrees of deficiency are as follows:
Circulating vitamin A concentrations become elevated (>200 mcg 1 dl) owing to vitamin A overload.
RECIPROCAL CROSSES Similar results were obtained with reciprocal crosses also. A reciprocal crosses involves the same traits but carried by sexes opposite to those in the origi
Techniques: operation is done under general endo tracheal anaesthesia. Patient is positioned with the left chest tilted up using a sand bag under left chest. Left antero latera
How do the ideas of energy and chemical cycles, community structure, biodiversity and succession fit together to form the basis of the way the natural world works?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is the Rh typing of the mother and of the fetus in the hemolytic disease of the newborn? In a hemolytic disease of the newborn the mother is Rh- and the fetus Rh+. In thes
Define the effect of Dietary fibre on Satiety? Satiety: Several investigators have speculated that ingestion of a high fibre food induces a feeling of satiety, reduces meal siz
How are lipids used as an energy source by the organism? Carbohydrates are the major energy source for aerobic cell respiration. In the absence or deficiency of such substances
Peri operative Myocardial Infarction : Peri operative Myocardial Infarction is diagnosed by the appearance of fresh Q waves. Non-Q, myocardial infarction is suspected when there
using examples of invertebrate phyla illustrate how the increase in complexity is reflected by their nervous system?
Promotion - Stages of carcinogenesis The second stage or promotion is reversible and does not include changes in structure of DNA but rather in the expression of the genome of
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd