Define radiological anatomy, Biology

Assignment Help:

Q. Define Radiological anatomy?

The borders of the mediastinum on the CXR are defined by the contrast produced by adjacent air filled lung.

Postero-Anterior View

It indicate the structures that form the mediastinal contours. The right ventricle is the only chamber that does not contribute to the cardiac silhouette on the PA view.

Lateral View

The lateral view is always used in combination with the PA view. In addition to defining specific chamber enlargement, it is particularly useful in the following situations:

i) Demonstrates lesions in the retrosternal and costophrenic regions.

ii) Localizes lung pathology to its lobe and assesses lobar volume loss.

iii) Defines interlobar or small pleural effusions.

iv) Separates diaphragmatic variants from adjacent lung or subdiaphragmatic pathology.

It illustrates the structures that are border forming on the lateral view. The right ventricle and pulmonary trunk form the anterior margins of the cardiac contour. The posterior border is formed by the left atrium and the left ventricle. There is a small contribution from the inferior vena cava (IVC)


Related Discussions:- Define radiological anatomy

What is specific gravity - properties of solutions, Specific Gravity Th...

Specific Gravity The density of a substance is defined as  mass per unit volume.  The density of a substance is a characteristic property and has a definite value at a given te

Cellular level - level of body organization, Cellular level - Level of body...

Cellular level - Level of body organization The next higher level of organization is the cellular level. This is really an aggregation of cells that are functionally different

Predation, Think back to the patterns of predator-prey cycling from Section...

Think back to the patterns of predator-prey cycling from Sections 2 and 3. Which of the three predator functional responses would you expect to be most likely to give stable popula

Is herbivorism a form of predatism, Is herbivorism a form of predatism? ...

Is herbivorism a form of predatism? Herbivorism is a type of predatism in which first order consumers feed from producers (plants or algae). For instance, birds and fruits, hum

Explain community dietitians, Explain Community dietitians Community d...

Explain Community dietitians Community dietitians or  nutritionists  may  counsel  individuals and  groups on  sound nutrition practices  to  prevent  disease, maintain  healt

List the routine treatment sequence for an implant patient, List the routin...

List the routine treatment sequence for an implant patient. The different phases are - Preliminary treatment - Stage I surgical phase - Stage II surgery and Prosthetic

Ornithine-urea cycle, Normal 0 false false false EN-IN ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Discuss about the function of tear film in short, Discuss about the functio...

Discuss about the function of Tear Film in short. Functions of Tear Film The normal function of the eye is dependent on sufficient supply of tear fluid- a secretion

Obelia, Obelia is considered to be of special interest in zoology as an ani...

Obelia is considered to be of special interest in zoology as an animal showing an intermediate grade of organization?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd