Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Define Radiological anatomy?
The borders of the mediastinum on the CXR are defined by the contrast produced by adjacent air filled lung.
Postero-Anterior View
It indicate the structures that form the mediastinal contours. The right ventricle is the only chamber that does not contribute to the cardiac silhouette on the PA view.
Lateral View
The lateral view is always used in combination with the PA view. In addition to defining specific chamber enlargement, it is particularly useful in the following situations:
i) Demonstrates lesions in the retrosternal and costophrenic regions.
ii) Localizes lung pathology to its lobe and assesses lobar volume loss.
iii) Defines interlobar or small pleural effusions.
iv) Separates diaphragmatic variants from adjacent lung or subdiaphragmatic pathology.
It illustrates the structures that are border forming on the lateral view. The right ventricle and pulmonary trunk form the anterior margins of the cardiac contour. The posterior border is formed by the left atrium and the left ventricle. There is a small contribution from the inferior vena cava (IVC)
Specific Gravity The density of a substance is defined as mass per unit volume. The density of a substance is a characteristic property and has a definite value at a given te
Cellular level - Level of body organization The next higher level of organization is the cellular level. This is really an aggregation of cells that are functionally different
Think back to the patterns of predator-prey cycling from Sections 2 and 3. Which of the three predator functional responses would you expect to be most likely to give stable popula
Is herbivorism a form of predatism? Herbivorism is a type of predatism in which first order consumers feed from producers (plants or algae). For instance, birds and fruits, hum
Explain Community dietitians Community dietitians or nutritionists may counsel individuals and groups on sound nutrition practices to prevent disease, maintain healt
List the routine treatment sequence for an implant patient. The different phases are - Preliminary treatment - Stage I surgical phase - Stage II surgery and Prosthetic
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Discuss about the function of Tear Film in short. Functions of Tear Film The normal function of the eye is dependent on sufficient supply of tear fluid- a secretion
Obelia is considered to be of special interest in zoology as an animal showing an intermediate grade of organization?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd