Define proteins as structural elements and structural units, Biology

Assignment Help:

Define Proteins as Structural Elements and Structural Units?

The liver cell membrane analysis shows that this membrane contains 50-60% protein, 35% lipids and 5% carbohydrates. The carbohydrate present is joined primarily to the protein forming glycoproteins, compounds which constitute the receptor sites of several hormones. The protein portion of the membrane is so oriented that its hydrophilic aspects are also in close proximity to the intracellular and extracellular fluids. The protein molecules are interspersed within the lipids and lend both structural stability and fluidity to the membrane. Membrane function depends on how the proteins are placed in the membrane and on the fluidity, which results from the combination of proteins in a lipid mixture. If the lipid is more saturated, a more rigid crystalline structure will form. Many lipids being fluid and less rigid, allow the proteins to change their shape in response to ionic changes and hence these proteins function as enzymes, carriers, binding or receptor sites or entry ports for a large variety of materials binding, entering or leaving the cell. Thus proteins serve as the structural and functional units of the cell membrane.

Proteins are also important intracellular structural units. Muscle is composed of 20% protein, 75% water and 5% inorganic mate ial, glycogen and other organic compounds. The major proteins in muscle are myosin - a large globular protein, and actin - a smaller globular protein. These two proteins, plus the filamentous tropomyosin and troponin a e the moleculas components of the muscles. The muscle proteins are characterized by their elasticity, which contributes to the contractile power of the tissue. The most important structural function of protein is related Lo skin and connective tissue. The skin is composed of epithelial tissue which covers not only the exterior of the body but also lines the gastrointestinal tract, respiratory tract and the urinary tract. One of the major proteins found in the skin is 'melanin'. Melanin is a tyrosine derivative and. provides the pigmentation or characteristic colour to the skin.

Persons unable to form this pigment are albinos and the disease is called 'albinism.' Keratin is the protein which forms hair, nails, hooves, feathers or horns. Each of these structures is slightly different but all contain keratin. This protein is insoluble in water and is resistant to most digestive enzymes. It has a high percentage of cystine. Connective tissue is that tissue which holds various cells and tissues together. It includes bones and teeth also, since they start with a matrix protein into which various amounts of minerals are deposited. Collagen and elastin are the two distinct types of proteins in the connective tissue. It contains protein, hydroxyproline and glycine. These proteins are not easily degradable and are inert metabolically. Even in protein deficient states, the body will synthesize collagen and elastin and these proteins will not be catabolized for needed amino acids. However, this protein can be degraded to a limited degree by boiling in acid. It is then converted to gelatin. The collagen of bone, skin, cartilage and ligaments differ in chemical composition from that of the white fibrous tissue which holds individual cells together within muscle, liver and other organs. Elastin and chondroalbumoid are two other proteins in the connective tissue. They are present in small amounts and serve as a part of the structural protein.


Related Discussions:- Define proteins as structural elements and structural units

The structure of leaves, The structure of leaves Borrow a microscope fr...

The structure of leaves Borrow a microscope from another school, a doctor, or a hospital. Study the under- side of leaves and locate the breathing pores or stomata with the two

Causes of cancer, Causes of Cancer We know earlier that a malignant tu...

Causes of Cancer We know earlier that a malignant tumor is a large aggregation of cancer cells, all of them descended from a single founder cell that was once a normal cell wi

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

fat digestion requires two steps, Fat digestion requires two steps? What a...

Fat digestion requires two steps? What are the steps and what enzymes are used to accomplish each step?

Explain the air sampling, Explain the Air Sampling? Microorganisms may ...

Explain the Air Sampling? Microorganisms may be present in air of processing facility and have an impact on the quality and safety of foods processed and handled there. To avoi

Benzoic acid and salts -preservative, Normal 0 false false ...

Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4

Plasma and its composition, PLASM A - It is slightly alkaline non-l...

PLASM A - It is slightly alkaline non-living intercellular substance which constitutes about 60% part of the blood. It is a pale yellow but transparent and clear fluid.

What is soil fertility evaluation, Soil fertility evaluation  In order ...

Soil fertility evaluation  In order to maintain soil fertility, nutrients removed from the soil by crops must be restored by the application of manures and fertilizers.  The se

Genome, Genome is the whole compliment of genetic material in the form of ...

Genome is the whole compliment of genetic material in the form of the permanently maintained DNA for the particular given organism. Its size is usually given as its total number o

Conduits-surgery for coronary artery disease, Conduits Figure: Ve...

Conduits Figure: Venous Conduits Reversed saphenous vein was the first conduit used for CABG. 'It is usually harvested from the leg starting above the ankle going up

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd