Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define Observation or Inference for fehling's test?
An insoluble reddish brown precipitate of cuprous oxide will be obtained. The reddish brown precipitate indicates the presence of a reducing sugar. All monosaccharides are reducing sugars and give a positive Fehling's test.
Note- Sometimes you may see some yellow or greenish coloured precipitate.
Maltose and lactose have a free aldehydes group due to which they are capable of reducing Fehling's solution.
Sucrose does not possess any free sugar group since the aldehyde group of glucose molecule and the ketone group of fructose molecule are tied up in a glycosidic linkage. Hence, there is no free sugar group available for enediol formation and sucrose cannot reduce metallic ions.
Starch is made up of several glucose units linked by a-1,4 glycosidic linkages in straight chains and branched through -1,6 glycosidic linkages . Thus, it has very few free sugar groups and is not capable of reducing cupric ions in Fehling's reagent.
Dextrin is the intermediate product of starch hydrolysis and is a less complex molecule. Thus, it possesses more free sugar groups than starch and can partially reduce Fehling's reagent.
Zygote - Embryogenesis The fertilized egg or zygote is situated at the micropylar end/pole of the embryo sac, its basal (micropylar) end is attached to the embryo sac wall and
Explain the Management of Renewable Resources? Since the human population has grown, human impacts on the resources that we use, like fisheries and forests, have continued to g
Q. Why is carbon monoxide toxic for humans? Hemoglobin "likes" carbon monoxide (CO) much more than it likes oxygen. When there is carbon monoxide in the inhaled air it binds to
PHYLUM PROTOZOA Definition and Introduction All unicellular ( or acellular ) eukaryotic animals. Most primitive (Gr. Protos = first=zoon= animals ) organisms
Nutrition
Define Vapor-pressure lowering and Osmotic pressure? 1. Vapor-pressure lowering: the decrease in the vapor pressure of a solution containing nonvolatile solutes, compared to th
list any 15 characteristics of phyla protozoa
What is the name of the cells capable of making gametes? What is the ploidy of these gamete-forming cells? The cells that form gametes are the germ cells as opposed to the soma
Q. Clinical Symptoms of diabetes mellitus? In mild cases of diabetes mellitus, no symptoms may be seen. The diagnosis could be incidental during a blood or urine investigation.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd