Define nutritional availability - microbial survival, Biology

Assignment Help:

Define Nutritional Availability - Microbial Survival and Growth?

Food borne microbes are chemotrophs. Generally the types of microorganisms present on a particular food are the ones that can utilize the food components optimally. For some microbes food merely acts as a carrier.


Related Discussions:- Define nutritional availability - microbial survival

Why waste considered major environmental issues, Q. Why is waste considered...

Q. Why is waste considered one of the major environmental issues? The environmental problem regarding waste worsens with industrial development and the global growth of consump

What is the significance of elastic capsule chromatophore, What is the sign...

What is the significance of Elastic capsule chromatophore? Specialized pigmented cells on surface of the cephalopods that, by changing their shape, expose differing amounts of

Difference between distant object and near object, Difference between Dista...

Difference between Distant object and Near object - Distan t object Near object   1. Parallel light reaches to eye.   2. Ci

What is predatism, Q. What is predatism? The Predatism is the ecologica...

Q. What is predatism? The Predatism is the ecological interaction in which one individual kills or mutilates another to get food. The Predatism is an inharmonious (negative) ec

Explain the obligatory losses of nutrients, Explain the Obligatory Losses o...

Explain the Obligatory Losses of Nutrients? Obligatory losses of nutrient are defined as 'the losses that occur when an individual is put on a diet free of that nutrient'. For

Cholesterol, CHOLESTEROL Other name is parental steroid. It is ...

CHOLESTEROL Other name is parental steroid. It is present all over the body but absent in cerebrospinal fluid. Cholesterol is found exclusively in animal food. It

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Determine the seeds in the plant kingdom, What is the evolutionary importan...

What is the evolutionary importance of the emergence of seeds in the plant kingdom? The evolutionary significance of the seed is related to the plant capability of distant colo

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd