Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define Nutritional Availability - Microbial Survival and Growth?
Food borne microbes are chemotrophs. Generally the types of microorganisms present on a particular food are the ones that can utilize the food components optimally. For some microbes food merely acts as a carrier.
Q. Why is waste considered one of the major environmental issues? The environmental problem regarding waste worsens with industrial development and the global growth of consump
genus of amoeba
What is the significance of Elastic capsule chromatophore? Specialized pigmented cells on surface of the cephalopods that, by changing their shape, expose differing amounts of
Difference between Distant object and Near object - Distan t object Near object 1. Parallel light reaches to eye. 2. Ci
Q. What is predatism? The Predatism is the ecological interaction in which one individual kills or mutilates another to get food. The Predatism is an inharmonious (negative) ec
Explain the Obligatory Losses of Nutrients? Obligatory losses of nutrient are defined as 'the losses that occur when an individual is put on a diet free of that nutrient'. For
CHOLESTEROL Other name is parental steroid. It is present all over the body but absent in cerebrospinal fluid. Cholesterol is found exclusively in animal food. It
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Characteristics of phylum porifera
What is the evolutionary importance of the emergence of seeds in the plant kingdom? The evolutionary significance of the seed is related to the plant capability of distant colo
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd