Define nutrient requirements and principles of meal planning, Biology

Assignment Help:

Define nutrient requirements and principles of meal planning?

In this , we started our discussion with the school age and its characteristics. We learnt about the physical growth and development patterns and psycho-social changes that occur in them. We discussed about their nutrient requirements and principles of meal planning for them. We also got to know about simple tips to improve their eating Behaviour and to correct their faulty eating habits and food choices.

Then, we moved on to the next stage i.e., adolescence which we saw, is a period of marked rapid growth. This growth, we learnt, occurs in spurts, has no calendar and differs in the two sexes. The difference is more evident in the area of body composition.We also studied that the adolescents undergo distinct sexual maturity and psychosocial changes. Social maturity has no targets and its complexities learnt lifelong. This is however a period of maximum peer pressure and urge for peer acceptance. The role of various nutrients in light of these changes was also emphasized.Finally, focus was laid on formation of sound dietary habits such as consuming healthy and nutritious breakfast, carrying wholesome Tiffin and inclusion of foods from all food groups. With regard to adolescents, the calcium and iron requirement need special attention as they are linked to growth and long term good health.

Various national programmes which are targeted for school children and adolescents are mid-day meal programme, ICDS, NIDDCP and anaemia prophylaxis programme. More initiatives are needed for prevention and treatment of obesity in children and controlling CHD from childhood. The common problems of nutrition in this age category are obesity, addressing teenager's mindset, eating out patterns, inadequate calcium, iron and certain eating disorders.


Related Discussions:- Define nutrient requirements and principles of meal planning

What is adaptive convergence?, What is adaptive convergence? The Adapti...

What is adaptive convergence? The Adaptive convergence is the phenomenon by which living beings facing the same environmental pressure (problems) and undergoing genetic variabi

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Describe the procedure of femoral approach, Q. Describe the procedure of fe...

Q. Describe the procedure of femoral approach? The catheter is inserted into the femoral sheath and advanced to the level of the left mainstem bronchus over the guidewire. Aft

Define functions of organic phosphorus, Define functions of Organic Phospho...

Define functions of Organic Phosphorus? It is involved in the following reactions/components: a) Structural component of nucleic acids: It is important component of DNA and

Metestrus - estrous cycle, Metestrus - Estrous cycle This occurs shortly...

Metestrus - Estrous cycle This occurs shortly after ovulation and is intermediate between estrus and diestrus. The period lasts for 10 to 14 hours and mating is usually not perm

Explain the term direct calorimetry, Explain the term Direct Calorimetry? ...

Explain the term Direct Calorimetry? Calorimetry refers to the measurement of the amount of heat evolved or absorbed in a chemical reaction, change of state, or formation of a

What is the neurotransmitter of the neuromuscular junction, What is the neu...

What is the neurotransmitter of the neuromuscular junction? How does the nervous system trigger muscle contraction? The nervous cells that trigger the muscle contraction are th

Biotechnology in conservation of animal biodiversity, Cryopreseravtion of g...

Cryopreseravtion of gametes , embryos or DNA segments can be quite an effective and safe approach for breeds or strains whose populations are too small to be conserved by any other

Valuation of biodiversity, Q. Show the Valuation of Biodiversity? Serio...

Q. Show the Valuation of Biodiversity? Serious research in this field has only been recently initiated and the methodologies for valuation are still evolving. Important valuat

What is cardiac catheterization, Q. What is Cardiac Catheterization? Ro...

Q. What is Cardiac Catheterization? Routine cardiac catheterization is not necessary in patients with mitral regurgitation. It may be done when there is discrepancy between cli

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd