Define mini nutritional assessment (mna) tool, Biology

Assignment Help:

Define Mini Nutritional Assessment (MNA) Tool?

It is a comprehensive and simple tool, which is able to categorize the subjects into three different categories like well nourished, at risk and undernourished. In most of the cases this tool eliminates the need for more invasive test such as blood sampling.

The MNA was developed and validated jointly by the Center for Internal Medicine and Clinical Gerontology of Toulouse (France), the Clinical Nutrition Programme at the University of New Mexico (United States), and the Nestle Research Center in Lausanne (Switzerland). The objective of this tool was to screen and assess the nutrition status as part of the standard evaluation of elderly patients in clinics, nursing homes, hospitals, or among those who are otherwise frail. The MNA is easy to administer, patient friendly, inexpensive, very sensitive (96%), highly specific (98%), and reproducible. The MNA comprises 18 items grouped in four sections :(l) anthropometric assessment  (weight, height, arm and calf circumferences, and weight loss); (2) general assessment  (six questions related to lifestyle, medication, and mobility); (3) dietary assessment  (eight questions related to number of meals, food and fluid intake, and autonomy of  feeding); and (4) subjective assessment (self-perception of health and nutrition).

The response to each item in the MNA had a numerical score. The total MNA score is calculated as the sum of the points assigned to the responses of the 18 items. The maximum value of the final score is 30. According to the obtained score using the questionnaire the MNA stratifies patients in: well nourished (24 = MNA < 30), at risk of under nutrition (17 = MNA = 23), and undernourished (MNA 47). The MNA is specifically designed to guide nutritional intervention by identifying the risk factors requiring correction. In fact, it is both a screening and assessment tool for the identification of malnutrition in the elderly.

 


Related Discussions:- Define mini nutritional assessment (mna) tool

Photosynthesis carbon dioxide, Q. Why is it said that during photosynthesis...

Q. Why is it said that during photosynthesis carbon dioxide is improved to form glucose? During photosynthesis carbon dioxide is energetically improve with hydrogen from water.

Microorganisms on basis of oxygen requirement for growth, Q. Microorganisms...

Q. Microorganisms on basis of oxygen requirement for growth? On basis of oxygen requirement for growth: - Obligate Aerobes: Require oxygen for growth and multiplication e.g

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Experiment of an egg osmometer, An egg osmometer Place some dilute hydr...

An egg osmometer Place some dilute hydrochloric acid or strong vinegar in a shallow dish, likeas a saucer, to a depth of about one centimetre. Hold the large end an egg in the

Skeletal system - cerebro-spinal fluid, Cerebro-spinal Fluid - Formed m...

Cerebro-spinal Fluid - Formed mainly by choroid plexus and ependyma of ventricles. It comes out of medulla oblongeta by foramen of magandie and lushka . Slightly alkalin

Define types of indicators, Define Types of Indicators? Macro indicator...

Define Types of Indicators? Macro indicators are used at strategic levels while micro indicators are used at performance levels. From the previous sections it is clear that man

Why is the human placenta referred to as haemochorial type, What is the opt...

What is the optimum percentage of forest area recommended by the national forest policy (1988) for the plains and the hills respectively? List any four problems caused because of d

What is glycogen metabolism, Glycogen is a multibranched polysaccharide whi...

Glycogen is a multibranched polysaccharide which serves as a part of energy storage in fungi and animals. In humans the glycogen is recognized and stored primarily in the cells of

Illustrate morphological evidence, Q. Illustrate Morphological Evidence? ...

Q. Illustrate Morphological Evidence? Morphology is the study of structure and form of plants and animals usually dealing with the organism and its component organs. Morphologi

Mechanism of maturation, Mechanism of Maturation The basic mechanism o...

Mechanism of Maturation The basic mechanism of maturation of ovum is more or less similar in all organisms. The primordial germ cells that enter into the ovary divide mitotica

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd