Define micronutrient needs of a lactating mother, Biology

Assignment Help:

 

Define Micronutrient needs of a lactating mother?

Vitamin and mineral deficiencies can have profound influence on the composition of milk. Calcium is a nutrient of special concern, since there are some reports in the literature that if the mother's diet is not adequate, it will be mobilized from her bones. This is especially of concern in case of prolonged lactation. Hence, the RDI for calcium is high for lactating mothers.

The requirements for other nutrients are all increased, reflecting the need for milk production and the need to replenish maternal stores. Folate needs are increased above non-pregnant levels but are not as high as during pregnancy. Iron needs are not increased during lactation because little iron is lost in milk, and in most women, losses are decreased because menstruation is absent. However, if the mother's iron status is poor, supplements of 30 mg of elemental iron per day may be recommended for the first 2 to 3 months of lactation to replete iron stores.

Besides these, water needs during lactation should be paid attention to. An increase in fluid intake does not increase milk volume; however, additional fluid is needed to maintain a normal maternal fluid balance. When fluid intake is low, the mother's urine will become more concentrated to conserve water for milk production. To avoid dehydration and ensure adequate milk production, fluid intake should be increased by about per day. 


Related Discussions:- Define micronutrient needs of a lactating mother

Determine by nutritive muscular cell?, Determine by nutritive muscular cell...

Determine by nutritive muscular cell? The cells which form the gastrodermis lining the inner cavity of cnidarians. They carry out two functions: First is to absorb and digest f

Fermentation, outline the process of yeast fermentation stating all enzymes...

outline the process of yeast fermentation stating all enzymes involved

What is modified blalock-taussig shunt explain, What is Modified Blalock-Ta...

What is Modified Blalock-Taussig Shunt explain? This is usually done by interpositioning a PTFE (Goretex) graft of 3.5 or 4 mm in a neonate. It is better done by a left lateral

Supernumerary or accessory chromosomes, SUPERNUMERARY OR ACCESSORY CHROMOSO...

SUPERNUMERARY OR ACCESSORY CHROMOSOMES Wilson (1905) discovered them in Matapodium insect. Very small Chromosomes present in nucleus in addition to normal number of Chr

Physical element with great amount of energy at earth origin, Which physica...

Which physical elements contributed to the great amount of available energy on the primitive earth at the time of the origin of life? 3.5 billion years since the water cycle wa

A patient was complaining of frequent urination, A patient was complaining ...

A patient was complaining of frequent urination, excessive thirst and dehydration. His fasting glucose level was found to be normal. Name the disease and its cause. Describe

Potential air pollutants encountered in working environment, Question: ...

Question: a) Why is it important to maintain good standards of Indoor Air Quality in modern offices. Briefly explain the potential air pollutants encountered in such working

What is concepts of chromosome, Q. What is the relation between the concept...

Q. What is the relation between the concepts of chromosome and chromatin? Are heterochromatin and euchromatin part of chromosomes? Every filament of chromatin is a complete DNA

Cell, Ask question #Minimum cell theory 100 words accepted#

Ask question #Minimum cell theory 100 words accepted#

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd