Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Define Maxillofacial Prosthodontics?
Dental implants are now been increasingly used for Maxillofacial Prosthodontics. Maxillofacial Prosthodontics involves the prosthetic rehabilitation of patients with congenital or acquired defects of the oral or facial areas. Some of the more challenging patients are those requiring rehabilitation of the mandibular resection and those receiving facial prosthesis. Application of the technology of osseointegration has provided treatment options with improved prognosis for these patients.
The movement of the chromosome is called anaphase A, and the extension of the poles is termed anaphase B.The mechanism of these movements are discussed below. Chromosome move
Explain the Consequences of Malnutrition? Malnutrition manifests itself in terms of illness and death in all age groups. Children, pregnant women, nursing mothers and elderly a
Explain Inhibitors Inhibitors: Citrate synthase is inhibited by ATP, NADH, succinyl CoA and acyl CoA derivative of fatty acids (fatty acyl CoA). The rate of the reaction is
Q. How are animals classified according to the germ layers present in their embryonic development? Cnidarians are diploblastic, that is they present only ectoderm and endoderm.
In studies of human body, which of the subsequent terms can also be used when referring to the pituitary gland? Is it: a) Pancreas b) Hypozthesis (pron: hypo-fi-sis) c) T
Q. Plant classification according to Ancient Greeks and Romans? Hippocrates, "The Father of Medicine" (460-377 B.C.) is reputed to have been one of Democritus 's disciples. He
how can explain
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is the indolacetic acid (IAA)? IAA or Indolacetic acid (indolyl-3-acetic acid) is the major natural auxin made by plants. It promotes plant growth and cellular differentia
Q. Which Of substance are microfilaments made and what are the properties of these elements that give motility to cells? Microfilaments are made of actin a protein. The contrac
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd