Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Define Maxillofacial Prosthodontics?
Dental implants are now been increasingly used for Maxillofacial Prosthodontics. Maxillofacial Prosthodontics involves the prosthetic rehabilitation of patients with congenital or acquired defects of the oral or facial areas. Some of the more challenging patients are those requiring rehabilitation of the mandibular resection and those receiving facial prosthesis. Application of the technology of osseointegration has provided treatment options with improved prognosis for these patients.
Q. What are the enzymes? What is the significance of enzymes for living beings? Enzymes are proteins that are catalysts of the chemical reactions. From Chemistry it is known as
Explain the Reproductive System? The human reproductive system produces not only reproductive organs and gametes, but also sex hormones, which have far-reaching effects on huma
SPLEEN Largest lymph gland, also with myeloid tissue is an important specialized reticuloendothelial organ in vertebrates, as the site of erythropoiesis. Splenic tissue i
A snapdragon plant that bred true for white petals was crossed to a plant that bred for purple petals, and all the F1 had white petals. The F1 was selfed. Among the F2, three other
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What are the major divisions of the hypophysis? What are their functions? The hypophysis is divided into two portions- the anterior hypophysis or adenohypophysis and the pos
Hybridoma is the clone of plasmacytoma cells which secrete a monoclonal antibody; commonly produced by the fusion of peripheral or splenic plasma cells taken from the immunized mo
write down the division of cryptogamae and phanerogamae
Explain the Types of cell Reproduction ? One of the major characteristics of living organisms is their ability to grow and reproduce. This is accomplished by cell division. In
Explain Class Bivalvia in animal kingdom? This name of this Class reflects the group's most distinguishing feature. Clams, oysters, scallops and mussels all have two shells tha
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd