Define maxillofacial prosthodontics, Biology

Assignment Help:

Q. Define Maxillofacial Prosthodontics?

Dental implants are now been increasingly used for Maxillofacial Prosthodontics. Maxillofacial Prosthodontics involves the prosthetic rehabilitation of patients with congenital or acquired defects of the oral or facial areas. Some of the more challenging patients are those requiring rehabilitation of the mandibular resection and those receiving facial prosthesis. Application of the technology of osseointegration has provided treatment options with improved prognosis for these patients.


Related Discussions:- Define maxillofacial prosthodontics

What are the enzymes, Q. What are the enzymes? What is the significance of ...

Q. What are the enzymes? What is the significance of enzymes for living beings? Enzymes are proteins that are catalysts of the chemical reactions. From Chemistry it is known as

Explain the reproductive system, Explain the Reproductive System? The h...

Explain the Reproductive System? The human reproductive system produces not only reproductive organs and gametes, but also sex hormones, which have far-reaching effects on huma

Spleen, SPLEEN Largest lymph gland, also with myeloid tissue is an i...

SPLEEN Largest lymph gland, also with myeloid tissue is an important specialized reticuloendothelial organ in vertebrates, as the site of erythropoiesis. Splenic tissue i

What were genotypes of the f2 plants crosses, A snapdragon plant that bred ...

A snapdragon plant that bred true for white petals was crossed to a plant that bred for purple petals, and all the F1 had white petals. The F1 was selfed. Among the F2, three other

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain major divisions of the hypophysis, Q. What are the major divisions ...

Q. What are the major divisions of the hypophysis? What are their functions? The hypophysis is divided into two portions- the anterior hypophysis or adenohypophysis and the pos

Hybridoma, Hybridoma is the clone of plasmacytoma cells which secrete a mo...

Hybridoma is the clone of plasmacytoma cells which secrete a monoclonal antibody; commonly produced by the fusion of peripheral or splenic plasma cells taken from the immunized mo

Diversty of living organisms, write down the division of cryptogamae and p...

write down the division of cryptogamae and phanerogamae

Explain the types of cell reproduction, Explain the Types of cell Reproduct...

Explain the Types of cell Reproduction ? One of the major characteristics of living organisms is their ability to grow and reproduce. This is accomplished by cell division. In

Explain class bivalvia in animal kingdom, Explain Class Bivalvia in animal ...

Explain Class Bivalvia in animal kingdom? This name of this Class reflects the group's most distinguishing feature. Clams, oysters, scallops and mussels all have two shells tha

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd