Define light source of microscope, Biology

Assignment Help:

Define Light Source of Microscope?

It is either mirror or electric illuminator present at the base. Identify the mirror in Figure. Some microscopes have reversible mirror with one side flat and other concave.

358_Bright Field Microscopes.png

Concave side of the mirror is used for sunlight and its flat side is used for artificial light, e.g., tungsten lamp. Other microscopes have built in light source.


Related Discussions:- Define light source of microscope

Explain fixed performance system in oxygen therapy, Explain fixed performan...

Explain fixed performance system in oxygen therapy? Fixed Performance Systems: These devices are capable of delivering a fixed, preset concentration of oxygen regardless of t

Cells, Suppose you were planning to use liposomes in an attempt to deliver ...

Suppose you were planning to use liposomes in an attempt to deliver drugs to a particular type of cell in the body, for example, a fat or muscle cell. Is there any way you might be

How is hemophilia treated, Q. How is hemophilia treated? Why is hemophilia ...

Q. How is hemophilia treated? Why is hemophilia rare in females? Hemophilia is medically treated with administration of factor VIII in case of hemophilia A or of factor IX in c

What is polyethylene, Q. What is Polyethylene? Polyethylene (P) (Low de...

Q. What is Polyethylene? Polyethylene (P) (Low density polyethylene (LDPE), medium density, linear low-density (LLDPE), high-density polyethylene (HDPE) and ethylene vinyl acet

#title, IN WHAT ASPECT ARE CNIDARIANS SIMILAR TO PROTOZOANS

IN WHAT ASPECT ARE CNIDARIANS SIMILAR TO PROTOZOANS

Special anatomic considerations in posterior maxilla, What are the special ...

What are the special anatomic considerations in posterior maxilla?  Posterior maxilla has very poor  quality of bone demanding special consideration in implant placement. These

Meat curing and smoking, Cu r in g and Smoking Meat curing refers to...

Cu r in g and Smoking Meat curing refers to the production of the characteristic thermally stable pink meat pigment and cured meat flavour by the action of sodium nitrite an

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Is transpiration the only way by which leaves lose water, Is transpiration ...

Is transpiration the only way through which leaves lose water? Plants do not only lose water as vapor, as by transpiration. The leaves also lose liquid water by a phenomenon c

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd