Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define Important Points While Working With Autoclave?
Note: Following points should be kept in mind while working with autoclave.
1. Autoclave should not be packed tightly otherwise steam won't be able to come in contact with every object in the autoclave.
2. The air initially present in autoclave chamber should be removed before closing exhaust valve, otherwise temperature won't reach to 121°C though the pressure would be 15 pounds.
3. For larger sample of liquid, autoclave time should be increased so that centre of the liquid should reach to 121°C.
4. After autoclaving, steam should be released slowly otherwise liquid media would come out. Besides autoclave, hot air ovens are also used for sterilization. Let us get to know about hot air ovens.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What do you mean by Transition Period? The transition period from the Renaissance to the Modern period produced many notable workers and much literature. Botanists gradually
Q. Technical Requirements for pulmonary angiography? Digital subtraction pulmonary angiography with selective pulmonary arterial injections is vastly superior to conventional c
Q What is the alternative means for transport of substances in animals without a circulatory system? Why is blood important for larger animals? In animals that don't present th
Amantadine Treatment with oral amantadine or rimantadine begun within 48 hours after the onset of illness decreases the duration of fever and symptoms by about 1 day. Whether t
1. Carbon monoxide (CO): It is colourless, odourless, tasteless gas and is not soluble in water. Source: CO is produced due to: (i) Incomplete combustion of fuels
how to draw a decomposition diagram
Q. How to Investigate mitral regurgitation by Electrocardiogram? Patients with severe mitral regurgitation often have atrial fibrillation. Left atrial enlargement is a common f
Successive Changes in Animal Life during Hydrosere The successive changes in plant communities in the different seral communities of a hydrosere. The question arises, is ther
Zinc Zinc regulates over a dozen important enzyme systems involved in metabolism of protein and carbohydrates. Zinc is also required for maintaining responsiveness of the immu
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd