Define important points while working with autoclave, Biology

Assignment Help:

Define Important Points While Working With Autoclave?

Note: Following points should be kept in mind while working with autoclave.

1. Autoclave should not be packed tightly otherwise steam won't be able to come in contact with every object in the autoclave.

2. The air initially present in autoclave chamber should be removed before closing exhaust valve, otherwise temperature won't reach to 121°C though the pressure would be 15 pounds.

3. For larger sample of liquid, autoclave time should be increased so that centre of the liquid should reach to 121°C.

 4. After autoclaving, steam should be released slowly otherwise liquid media would come out. Besides autoclave, hot air ovens are also used for sterilization. Let us get to know about hot air ovens.

 


Related Discussions:- Define important points while working with autoclave

Islet of langerhans, Islet of Langerhans: They are insulin-producing tissue...

Islet of Langerhans: They are insulin-producing tissues. It was discovered by Paul Langerhans in 1869. These cells are in groups and look like islands in the pancreas. There are ab

Causes of oesophagitis, Q. Causes of oesophagitis? The causes include t...

Q. Causes of oesophagitis? The causes include tissue erosion by hydrocliloric acid (EIC1) and pepsin, with symptoms of substernal burning, cramping, pressure sensation or sever

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Advice on follow up for cardiac patients, Advice on Follow up The pa...

Advice on Follow up The patient should adhere to the follow-up schedule strictly. Generally, one week after discharge, then one month and then 3 to 6 months interval, the

Infectious bronchitis (ib), I nfectious bronchitis (IB) Infectious bro...

I nfectious bronchitis (IB) Infectious bronchitis is a highly contagious respiratory disease of poultry, caused by a virus belonging to the family Coronaviridae. Its existence

What are the two major types of endocytosis, Q What are the two major types...

Q What are the two major types of endocytosis? Endocytosis is the entry of material in the cell engulfed by portions of the cell membrane. Endocytosis can be classified as p

Meiosis, does crossing over occur in all the homologous chromosomes???

does crossing over occur in all the homologous chromosomes???

Explain about the oral cavity and alimental-y tract, Explain about the Oral...

Explain about the Oral cavity and alimental-y tract? Various functional changes and decline in secretary function occur in the digestive tract with aging. These include: Or

Explain about the rna viruses - carcinogenic, Explain about the RNA Viruses...

Explain about the RNA Viruses - carcinogenic? All oncogenic RNA viruses are retroviruses. They are of 2 types. They are acute transforming retroviruses and slow transforming re

Pathophysiology and assessment of iron deficiency anaemia, Pathophysiology ...

Pathophysiology   Insufficient  amount of iron present in the body leads  to reduction in serum transferrin (Serum betaglobulin, which binds and transports iron) saturation.  T

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd