Define important points while working with autoclave, Biology

Assignment Help:

Define Important Points While Working With Autoclave?

Note: Following points should be kept in mind while working with autoclave.

1. Autoclave should not be packed tightly otherwise steam won't be able to come in contact with every object in the autoclave.

2. The air initially present in autoclave chamber should be removed before closing exhaust valve, otherwise temperature won't reach to 121°C though the pressure would be 15 pounds.

3. For larger sample of liquid, autoclave time should be increased so that centre of the liquid should reach to 121°C.

 4. After autoclaving, steam should be released slowly otherwise liquid media would come out. Besides autoclave, hot air ovens are also used for sterilization. Let us get to know about hot air ovens.

 


Related Discussions:- Define important points while working with autoclave

Pathogenesis, The interactions between the human host and selected microorg...

The interactions between the human host and selected microorganisms that culminate in IE involve the vascular endothelium, hemostatic mechanisms, the host immune system, gross anat

Explain the stages in taxonomic procedures - gamma taxonomy, Explain the st...

Explain the stages in taxonomic procedures - Gamma Taxonomy This phase of taxonomy is also called biological taxonomy and is concerned with the study of speciation. It is inclu

Determine the biologic response, Determine the biologic response The bi...

Determine the biologic response The biologic response can include: i) Metabolic disturbance. ii) Inflammatory response iii) Immune response iv) Mutagenesis v) Ca

Which type of energy is used in photosynthesis transformed, Q. Into which t...

Q. Into which type of energy is the light used in photosynthesis transformed? The luminous energy used in the photosynthesis is transformed in to the chemical energy.

International codes used for system of binomial nomenclature, Q. Internatio...

Q. International Codes used for system of binomial nomenclature? In 1753 Linnaeus suggested a system of binomial nomenclature where each individual is denoted by two epithets,

Describe the factors of biological evolution of humans, Although there are ...

Although there are differences in interpretation of the evidence, it is generally accepted that human biological evolution has not been a linear progression from one species to the

Mode of nutrition, What is the mode of nutrition of Ascaris?

What is the mode of nutrition of Ascaris?

Unicellular organisms, How was it proved in the case of Amoeba that the key...

How was it proved in the case of Amoeba that the key to the life of a cell is Nucleus?

How to use subcellular fractionation and a western blot, A virus capsid con...

A virus capsid containing vimentin, your protein of interest, gets into the cell nucleus and is broken down with the DNA being released. It is unknown whether the capsids themselve

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd