Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define Important Points While Working With Autoclave?
Note: Following points should be kept in mind while working with autoclave.
1. Autoclave should not be packed tightly otherwise steam won't be able to come in contact with every object in the autoclave.
2. The air initially present in autoclave chamber should be removed before closing exhaust valve, otherwise temperature won't reach to 121°C though the pressure would be 15 pounds.
3. For larger sample of liquid, autoclave time should be increased so that centre of the liquid should reach to 121°C.
4. After autoclaving, steam should be released slowly otherwise liquid media would come out. Besides autoclave, hot air ovens are also used for sterilization. Let us get to know about hot air ovens.
The interactions between the human host and selected microorganisms that culminate in IE involve the vascular endothelium, hemostatic mechanisms, the host immune system, gross anat
Explain the stages in taxonomic procedures - Gamma Taxonomy This phase of taxonomy is also called biological taxonomy and is concerned with the study of speciation. It is inclu
Determine the biologic response The biologic response can include: i) Metabolic disturbance. ii) Inflammatory response iii) Immune response iv) Mutagenesis v) Ca
Q. Into which type of energy is the light used in photosynthesis transformed? The luminous energy used in the photosynthesis is transformed in to the chemical energy.
Q. International Codes used for system of binomial nomenclature? In 1753 Linnaeus suggested a system of binomial nomenclature where each individual is denoted by two epithets,
Although there are differences in interpretation of the evidence, it is generally accepted that human biological evolution has not been a linear progression from one species to the
What is the mode of nutrition of Ascaris?
How was it proved in the case of Amoeba that the key to the life of a cell is Nucleus?
A virus capsid containing vimentin, your protein of interest, gets into the cell nucleus and is broken down with the DNA being released. It is unknown whether the capsids themselve
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd