Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define Important Points While Working With Autoclave?
Note: Following points should be kept in mind while working with autoclave.
1. Autoclave should not be packed tightly otherwise steam won't be able to come in contact with every object in the autoclave.
2. The air initially present in autoclave chamber should be removed before closing exhaust valve, otherwise temperature won't reach to 121°C though the pressure would be 15 pounds.
3. For larger sample of liquid, autoclave time should be increased so that centre of the liquid should reach to 121°C.
4. After autoclaving, steam should be released slowly otherwise liquid media would come out. Besides autoclave, hot air ovens are also used for sterilization. Let us get to know about hot air ovens.
Islet of Langerhans: They are insulin-producing tissues. It was discovered by Paul Langerhans in 1869. These cells are in groups and look like islands in the pancreas. There are ab
Q. Causes of oesophagitis? The causes include tissue erosion by hydrocliloric acid (EIC1) and pepsin, with symptoms of substernal burning, cramping, pressure sensation or sever
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Advice on Follow up The patient should adhere to the follow-up schedule strictly. Generally, one week after discharge, then one month and then 3 to 6 months interval, the
I nfectious bronchitis (IB) Infectious bronchitis is a highly contagious respiratory disease of poultry, caused by a virus belonging to the family Coronaviridae. Its existence
Q What are the two major types of endocytosis? Endocytosis is the entry of material in the cell engulfed by portions of the cell membrane. Endocytosis can be classified as p
does crossing over occur in all the homologous chromosomes???
Explain about the Oral cavity and alimental-y tract? Various functional changes and decline in secretary function occur in the digestive tract with aging. These include: Or
Explain about the RNA Viruses - carcinogenic? All oncogenic RNA viruses are retroviruses. They are of 2 types. They are acute transforming retroviruses and slow transforming re
Pathophysiology Insufficient amount of iron present in the body leads to reduction in serum transferrin (Serum betaglobulin, which binds and transports iron) saturation. T
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd