Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Let us now understand the definition, causes, signs and symptoms, diagnosis and treatment of hypoglycaemia. It is very important for you to learn about it because patient will be having hypoglycaemia due to various reasons and immediate care should be provided and patient should also be aware of signs and symptoms.
Hypoglycaemia is defined as state of low blood glucose level of less than 50mg/dl. Low blood sugar level varies from person to person.
Capacity to do work is known as energy. It is very important input for all our activities like cooking food, driving vehicle and running industries. The most important challenge th
Iron deficiency should be treated with supplemental iron. • Osteoporosis should be treated with calcium and vitamin D supplements. • Depending on individual factors, patien
Define plasma as Fluid Compartment - extracellular fluid? Plasma is the only major fluid compartment that exists as real collection of fluid all in one location. It differs fro
Q. Indications for Surgery of mitral regurgitation? Surgery is indicated in all symptomatic patients (class II and above) with severe mitral regurgitation and normal or decreas
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
SEMEN - Sperms and secretion of accesory glands collectively known as seminal fluid or semen. It is milky, semi-solid in nature having particular smell. pH : 7.35 - 7.5. Spe
Different sources of infection: There are many sources of infection such as reservoirs, carrier organisms and lifeless objects. Reservoirs : A habitat where the disease cau
ime day 0 day 1 day 3 day 4 day 5 day 7 count blank 7 10 5 14 9 8 low 45&49 64&70 62&69 75&79 80&82 68&72
Q. What is ancylostomiasis? The Ancylostomiasis is a disease caused by the Necator americanus or Ancylostoma duodenale both hookworms belonging to the nematode phylum (roundwor
An mRNA molecule codifies only one type of protein? Eukaryotic cells have monocistronic mRNA, i.e., every mRNA codifies only one polypeptide chain. Prokaryotes can present poly
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd