Define hypoglycaemia, Biology

Assignment Help:

Let us now understand the definition, causes, signs and symptoms, diagnosis and treatment of hypoglycaemia. It is very important for you to learn about it because patient will be having hypoglycaemia due to various reasons and immediate care should be provided and patient should also be aware of signs and symptoms.

Hypoglycaemia is defined as state of low blood glucose level of less than 50mg/dl. Low blood sugar level varies from person to person.


Related Discussions:- Define hypoglycaemia

Renewable energy sources, Capacity to do work is known as energy. It is ver...

Capacity to do work is known as energy. It is very important input for all our activities like cooking food, driving vehicle and running industries. The most important challenge th

Nutritional deficiency, Iron deficiency should be treated with supplemental...

Iron deficiency should be treated with supplemental iron. • Osteoporosis should be treated with calcium and vitamin D supplements. • Depending on individual factors, patien

Define plasma as fluid compartment - extracellular fluid, Define plasma as ...

Define plasma as Fluid Compartment - extracellular fluid? Plasma is the only major fluid compartment that exists as real collection of fluid all in one location. It differs fro

Indications for surgery of mitral regurgitation, Q. Indications for Surgery...

Q. Indications for Surgery of mitral regurgitation? Surgery is indicated in all symptomatic patients (class II and above) with severe mitral regurgitation and normal or decreas

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Male reproductive system - semen, SEMEN - Sperms and secretion of acces...

SEMEN - Sperms and secretion of accesory glands collectively known as seminal fluid or semen. It is milky, semi-solid in nature having particular smell. pH : 7.35 - 7.5. Spe

Different sources of infection, Different sources of infection: There a...

Different sources of infection: There are many sources of infection such as reservoirs, carrier organisms and lifeless objects. Reservoirs : A habitat where the disease cau

Culturing, ime day 0 day 1 day 3 day 4 day 5 day 7 count ...

ime day 0 day 1 day 3 day 4 day 5 day 7 count blank 7 10 5 14 9 8 low 45&49 64&70 62&69 75&79 80&82 68&72

What is ancylostomiasis, Q. What is ancylostomiasis? The Ancylostomiasi...

Q. What is ancylostomiasis? The Ancylostomiasis is a disease caused by the Necator americanus or Ancylostoma duodenale both hookworms belonging to the nematode phylum (roundwor

An mrna molecule codifies only one type of protein, An mRNA molecule codifi...

An mRNA molecule codifies only one type of protein? Eukaryotic cells have monocistronic mRNA, i.e., every mRNA codifies only one polypeptide chain. Prokaryotes can present poly

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd