Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define Hydroxybenzoic acid and Hydroxycinnamic acid?
Hydroxybenzoic acid: e.g. ellagic and gallic acids, which are hydrolyzable tannins, present in berries and nuts.
Hydroxycinnamic acid: e.g. caffeic and ferulic acids, which are heat-sensitive. Caffeic acid is a precursor of lignin. Caffeic with qunic acid gives chlorogenic acid. They occur in fruits, vegetables notably seeds, coffee beans, grains, sunflower seeds. Among these, curculnin and chlorogenic ncid have been studied more. Anticarcinogenic effects are attributed to caffeic and ferulic acid. They may act in two ways:
a) Prevent formation of carcinogens from precursors, and
b) Block reaction of carcinogens with critical cellular macroinolecules.
Sickle cell anaemia in man is caused by a defective chain of haemoglobin. The abnormal haemoglobin known as MbS differs from natural haemoglobin (HhA) in one amino acid. A substitu
Explain about the Lactation Process? Lactation is a physiologic process which has profound relevance for both the mother and the newborn. It is the period following pregnancy w
Define interaction of vitamin c with Pyridoxine? Pyridoxine is involved in glyconeogenesis through its action in transaminase reactions. Low levels of pyridoxine impair glucose
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Homomorphic Types - Intra specific Incompatibility It is characterized by morphologically indistinguishable mating types within a species. A proper breeding is required for th
Explain the Procedure for Preparation of Bacterial Smear? Start the exercise by following the steps enumerated herewith. (1) Take properly washed and dried glass slides for
a) The West of Scotland Coronary Prevention Study (WOSCOPS): The study randomized healthy men between the ages of 45 and 64 years with TC levels higher that 252 mg/dL and LDL chole
What are the differences b/w bone and cartiledge
FAC E - It lies under the anterior part of cranium. It is composed of 14 bones. These includes 2 nasals, 2 maxillae, 2 palatine, 2 zygomatic, 2 lacrymals, 2 inferior
Q. What are the special structures of the avian digestive tube and their respective functions? The crop has the function of temporary storage of ingested food and it is a more
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd