Define foam spray drying method, Biology

Assignment Help:

Define Foam Spray Drying Method?

This is an extension of spray drying and involves the use of gases dissolved under pressure prior to spraying. The main advantage is that the density of the product is reduced by half and the dried particles are hollow spheres surrounded by thick walls of dried material. The foam process produces particles having many internal spaces and relatively thin wall.

Related Discussions:- Define foam spray drying method

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Infructescences- pseudofruits and parthenocarpic fruits, What are the infru...

What are the infructescences, pseudofruits and parthenocarpic fruits? The Infructescences are aggregated fruits formed from inflorescences, aggregated flowers. Grape clusters a

Factors affecting water requirements of microorganisms, Q. Factors Affectin...

Q. Factors Affecting Water requirements of microorganisms? Factors that may affect aw requirements of microorganisms include: 1. Kind of solute employed to reduce the aw: F

Taxonomy, what arachnid is beneficial

what arachnid is beneficial

Viruses, are viruses cellular organisms

are viruses cellular organisms

In hormonal terms why does menses occur, Q. In hormonal terms why does mens...

Q. In hormonal terms why does menses occur? Menses is the endometrial monthly desquamation that occurs as the progesterone and estrogen levels fall after the regression of the

Immediate post-operative care to a cardiac patient, Immediate Post-operativ...

Immediate Post-operative Care The patient is accompanied to the ICU by a surgeon, anesthetist and the nurse who assisted for the surgery with portable ventilator and ECG

Bud grafting, Bud grafting A 'T' shaped incision is made on the bark...

Bud grafting A 'T' shaped incision is made on the bark of the stock. A bark is removed on either side of vertical cut. A single bud scion with a little wood is placed

What are the major factors of colloidal dispersion, What are the major fact...

What are the major factors of colloidal dispersion The adsorption of ions by colloidal particles is a major factor in stabilizing a colloidal dispersion, since the colloidal pa

How many different gene types are possible, In lab rats, hair color and tex...

In lab rats, hair color and texture are controlled by two genes, the A gene for color and the B gene for texture. in both of these genes, the alleles show no dominance to each othe

Write Your Message!

Name

Email id

Message

Verfication Code

User Account

All Pages