Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define Fermented Baked Preparations
In baked products such as bread and bun, the yeast Saccharomyces cerevisiae which is popularly known as "baker's yeast", helps by raising the dough giving it the texture and also adding flavours. The different ingredients added gives distinctly different tastes to each of the products. (refined wheat flour) to which salt, yeast or curd is added. It is kneaded vigorously for 15 minutes adding vegetable oil for softening. It is allowed to ferment for 30 minutes - 1 hour. It is then baked rapidly for 5 to 10 minutes. Intense heat causes centre of the dough to expand rapidly and create a central pouch.Saccharomyces cerevisiae is mainly responsible for leavening by carbon dioxide production
identifying characters of pennetula
Types of Aortic Stenosis: Obstruction to left ventricular outflow is commonly at the valvar level. Less commonly it is at the sub valvar or supra valvar level. Sub valvar ob
NatURAL SELECTION IN BIOLOGY
RECORDS AND REPORTS: The principles of administration are described as 'POSDCORB'. The 'R' stands for recording and reporting. Recording and reporting is related to all oth
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Is pollution always caused by humans? In the most cases pollution is caused by human activity. Other species and some abiotic factors though can also pollute an ecosystem. F
Dr. Don McPhail and his colleagues hypothesized that the existence of the benthic and limnetic sticklebacks is the result of allopatric speciation. Although this may be true for so
Q. How does the breathing process correct alkalosis? If the body undergoes alkalosis the respiratory center located in the medulla gets the information and induces the lowering
What are the major gas exchange organs of the plants? How is the procedure accomplished? In covering of the leaves and of the primary structure of the stem gas exchange is made
Changes in the Ions The concentration of potassium, phosphate and nitrate declined significantly in the bathing medium within four days. The concentration of so
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd