Define fermented baked preparations, Biology

Assignment Help:

Define Fermented Baked Preparations

In  baked products  such  as  bread and bun,  the  yeast  Saccharomyces cerevisiae which is popularly known as "baker's  yeast", helps by raising the dough giving it the texture  and  also  adding flavours. The different ingredients added gives distinctly different tastes to each of the products. (refined wheat flour) to which salt, yeast or curd is added. It is kneaded vigorously for 15 minutes adding vegetable oil for softening. It is allowed to ferment for 30 minutes  - 1 hour. It  is  then baked rapidly for  5  to  10 minutes. Intense heat causes centre  of  the  dough  to  expand  rapidly and  create  a  central pouch.Saccharomyces  cerevisiae  is mainly responsible for leavening  by  carbon dioxide production


Related Discussions:- Define fermented baked preparations

Pennetula, identifying characters of pennetula

identifying characters of pennetula

Types of aortic stenosis-aortic stenosis-valve disease, Types of Aortic Ste...

Types of Aortic Stenosis:  Obstruction to left ventricular outflow is commonly at the valvar level. Less commonly it is at the sub valvar or supra valvar level. Sub valvar ob

Records and reports - nursing service administration, RECORDS AND REPORTS: ...

RECORDS AND REPORTS: The principles of administration are described as  'POSDCORB'.  The  'R' stands for recording and reporting. Recording and reporting is related to all oth

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Is pollution always caused by humans, Q. Is pollution always caused by huma...

Q. Is pollution always caused by humans? In the most cases pollution is caused by human activity. Other species and some abiotic factors though can also pollute an ecosystem. F

What is the development of benthics, Dr. Don McPhail and his colleagues hyp...

Dr. Don McPhail and his colleagues hypothesized that the existence of the benthic and limnetic sticklebacks is the result of allopatric speciation. Although this may be true for so

How does the breathing process correct alkalosis, Q. How does the breathing...

Q. How does the breathing process correct alkalosis? If the body undergoes alkalosis the respiratory center located in the medulla gets the information and induces the lowering

What are the major gas exchange organs of the plants, What are the major ga...

What are the major gas exchange organs of the plants? How is the procedure accomplished? In covering of the leaves and of the primary structure of the stem gas exchange is made

Changes in the ions, Changes in the Ions The concentration o...

Changes in the Ions The concentration of potassium, phosphate and nitrate declined significantly in the bathing medium within four days. The concentration of so

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd