Define exocytosis , Biology

Assignment Help:

A cell frequently wants to secrete larger molecules than can be accommodated through the transport systems dealt with in Topic E3. Exocytoses get to the movement of proteins out of the cell across the plasma membrane into the extracellular space. The Proteins  intended  to  be  secreted  from  the  cell  are  interpreted   on  ribosome's attached to the RER. Membrane-bound vesicles having these proteins then bud off from the RER, migrate by the cytosol and fuse with the membrane of the Golgi apparatus that is given in the figure. On transport by the endoplasmic Golgi and reticulum    apparatus,   various    post- translational modifications to the proteins take place, like as glycosylation.

 

865_22.png

            figure:  Exocytosis of proteins by the constitutive and regulated secretory pathways.


Related Discussions:- Define exocytosis

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define role of buffer in electrophoresis, Define Role of Buffer in Electrop...

Define Role of Buffer in Electrophoresis? Buffer ions have a two-fold purpose in electrophoresis, they carry the applied current, and they fix the pH at which electrophoresis i

Define the fluidized dryers, Define the Fluidized Dryers? Fluidization ...

Define the Fluidized Dryers? Fluidization occurs when a flow of fluid upwards through a bed of particles (ranging from fine powders to particulate foods such as diced carrots)

Pain receptors, What information does the pain receptor relay to the brain ...

What information does the pain receptor relay to the brain about stimuli below threshold

Objective of nutrient needs during periods of pregnancy, Define Objective o...

Define Objective of nutrient needs during periods of pregnancy? describe the various physiological changes during pregnancy, describe foetal growth and development and

Elaborate the internal vascular circulation of an eye, Elaborate the intern...

Elaborate the internal vascular circulation of an eye. Retinal vessels are derived from central retinal artery and are distributed within the inner two-third of retina. Outer o

What are some factors that can lead to protein denaturation, What are some ...

What are some factors that can lead to protein denaturation? Protein denaturation can be caused by temperature variation, pH change, alters in the concentration of surrounding

Monohybrid cross, why does the monohybrid always result in a 1:2:1 ratio?

why does the monohybrid always result in a 1:2:1 ratio?

Vitamins requirements for ulcerative colitis, Q. Vitamins requirements for ...

Q. Vitamins requirements for ulcerative colitis? Vitamins: Commercial multivitamin preparation should be administered orally especially the ones needed for the healing process

Response to cold - responses of plants to stress, Response to Cold - Respon...

Response to Cold - Responses of Plants to Stress Let us first see what happen to a plant when it is exposed to a cold climate with temperatures below 0°C. If the temperature i

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd