Define etiology - anorexia nervosa, Biology

Assignment Help:

Define Etiology - Anorexia Nervosa?

The exact cause of eating disorders is not known. It is multi factorial in origin in which the personality of the patient, family relationship, socio-cultural factors and may be genetic factors play an important role. Although the fundamental causes of anorexia nervosa remain elusive, there is growing evidence that interacting socio-cultural and biological factors contribute to its causation, as do less specific psychological mechanism and a vulnerability of personality. It is possible that the disorders begin when there are disturbed family relationships, e.g., when the parents pretend to be getting along well with each other but are actually highly dissatisfied with their marriage. Such a family may be overprotective, rigid and too goal oriented. Some may have unusual interest in weight, food or shape of the body. The eating disorder for the child in such a family serves as a focus in order to bring control into an otherwise chaotic life.

It is not clear how these factors lead to intense fear of being fat that is central to both anorexia and other eating disorders like bulimia about which we shall learn later in this unit. Psychiatric illnesses like depression and obsessive compulsive behaviour very frequently are found in those with eating disorders, especially bulimia. These abnormalities may predispose to the development of eating disorders. Cultural factors are important. Today everyone wants to be healthy and fit. This may reinforce the fear of fatness in an emotionally unstable person; and may tip the borderline case into frank disorder. Occupation may also play a role. Dancers have a prevalence of anorexia nervosa 10 times that of the general population. Some studies show that a genetic component may be involved as well. However, such involvement in the causation of these disorders is considered only minor, if at all it exists. Apart from these, other multidimensional causative factors that lead to anorexia nervosa are: vulnerable personality; psychological conflicts - individual and family; socio-cultural factors -cult of thinness, hazardous dieting, social class and race and finally genetic and constitutional factors.


Related Discussions:- Define etiology - anorexia nervosa

When conducting the hair comparison, When conducting a hair comparison, wha...

When conducting a hair comparison, what factors would you consider?

How are animals classified according to the germ layers, Q. How are animals...

Q. How are animals classified according to the germ layers present in their embryonic development? Cnidarians are diploblastic, that is they present only ectoderm and endoderm.

Distinguish between epithelial and connective tissues, Distinguish between ...

Distinguish between epithelial and connective tissues with respect to their cell arrangement? PROVIDE a specific example (for both tissue types) of how the arrangement of cells hel

Explain the periapical surgery - endodontic surgery, Explain the Periapical...

Explain the Periapical surgery - Endodontic Surgery a) Curretage 1 b) Root-end ressection 2 c) Root-end preparation 3 d) Root-end filling 4

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Difference between carriers of hiv and aids patients, What is the differenc...

What is the difference between carriers of HIV and AIDS patients? A person can be a carrier of the HIV without necessarily being affected by the immunodeficiency syndrome at t

Oxaloacetate to malate, Oxaloacetate to Malate Oxaloacetate to Malate:...

Oxaloacetate to Malate Oxaloacetate to Malate: Oxaloacetate cannot  permeate mitochondria 1 membrane well and it must be transported across the membrane in the form of malate

How are the epithelial tissues classified, How are the epithelial tissues c...

How are the epithelial tissues classified? The epithelial tissues are classified according to the shape of the cells that form it (epithelial cells may be cuboidal, columnar, o

Argument, do you can write argument i will send you the article you want wr...

do you can write argument i will send you the article you want write from with rules please call me at 623-552-8532

Neurological disorders due to imbalanced nutritional intake, Define Neurolo...

Define Neurological disorders arising due to imbalanced nutritional intake (deficiency or excess)? Common examples are the neurological manifestations  of beriberi, pellagra, p

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd