Define eosin - methylene blue (emb) agar (levine), Biology

Assignment Help:

Define Eosin - Methylene Blue (EMB) Agar (Levine)

Peptone - 10.0 gm

Lactose - 5.0 gm

Dipotassium - 2.0 gm

Hydrogen Phosphate

Agar - 13.5 gm

Eosin Y - 0.4 gm

Methylene blue - 0.065 gm

Distilled water - 1000 ml

pH - 7.2

Dissolve the ingredients and autoclave at 15 psi before dispensing it into sterile plates and tubes. The medium is used for distinguishing lactose fermenting gram negatives from non-lactose fermenting types.


Related Discussions:- Define eosin - methylene blue (emb) agar (levine)

To test the gas given off when seeds germinate, To test the gas given off w...

To test the gas given off when seeds germinate Place some mustard seeds in a flask with some damp cotton wool, in the apparatus shown in the diagram, and permit them to germina

What is congenital heart operations and interventions, What is Congenital H...

What is Congenital Heart Operations And Interventions Aftercare of the children who have undergone cardiac procedures and surgeries is as important, and in some occasions, more

Features of estuaries, Features of Estuaries The physicochemical prop...

Features of Estuaries The physicochemical properties of the estuaries have large variation in several parameters and this often creates stressful environment for organisms. T

Oceanic islands, Oceanic islands are interesting and somewhat specialised b...

Oceanic islands are interesting and somewhat specialised biomes. Islands which have broken away from the main continents have similarity of flora and fauna related to the continent

Enumerate the term - pathognomic sign, Enumerate the term - pathognomic sig...

Enumerate the term - pathognomic sign A comprehensive assessment ideally uses all four approaches. Some forms of specialised assessment rely heavily on pathognomic signs, behav

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Inhibition model - models of succession, Inhibition Model - Models of Succe...

Inhibition Model - Models of Succession According to this model, succession is very heterogenous because the development at any one site depends on who gets there first. Speci

What are other organs and tissues made from that germ layer, From which ger...

From which germ layer do the epidermis and the nervous system originate? What are other organs and tissues made from that germ layer? Epidermis and nervous system have the simi

Agro industrial-sea weeds, Sea weeds Besides lakes, rivers and ponds, ...

Sea weeds Besides lakes, rivers and ponds, India has two thousands kilometers long coastline and wide variety of aquatic plants are abundantly available which are regarded mor

Representation of the metabolism, Biological effects: Aflatoxins are acute ...

Biological effects: Aflatoxins are acute hepatotoxins and are known to be carcinogenic in some animal species as rat. Aflatoxin B1 is acutely toxic and is responsible for liver nec

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd