Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define Eosin - Methylene Blue (EMB) Agar (Levine)
Peptone - 10.0 gm
Lactose - 5.0 gm
Dipotassium - 2.0 gm
Hydrogen Phosphate
Agar - 13.5 gm
Eosin Y - 0.4 gm
Methylene blue - 0.065 gm
Distilled water - 1000 ml
pH - 7.2
Dissolve the ingredients and autoclave at 15 psi before dispensing it into sterile plates and tubes. The medium is used for distinguishing lactose fermenting gram negatives from non-lactose fermenting types.
To test the gas given off when seeds germinate Place some mustard seeds in a flask with some damp cotton wool, in the apparatus shown in the diagram, and permit them to germina
What is Congenital Heart Operations And Interventions Aftercare of the children who have undergone cardiac procedures and surgeries is as important, and in some occasions, more
Features of Estuaries The physicochemical properties of the estuaries have large variation in several parameters and this often creates stressful environment for organisms. T
Oceanic islands are interesting and somewhat specialised biomes. Islands which have broken away from the main continents have similarity of flora and fauna related to the continent
Enumerate the term - pathognomic sign A comprehensive assessment ideally uses all four approaches. Some forms of specialised assessment rely heavily on pathognomic signs, behav
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Inhibition Model - Models of Succession According to this model, succession is very heterogenous because the development at any one site depends on who gets there first. Speci
From which germ layer do the epidermis and the nervous system originate? What are other organs and tissues made from that germ layer? Epidermis and nervous system have the simi
Sea weeds Besides lakes, rivers and ponds, India has two thousands kilometers long coastline and wide variety of aquatic plants are abundantly available which are regarded mor
Biological effects: Aflatoxins are acute hepatotoxins and are known to be carcinogenic in some animal species as rat. Aflatoxin B1 is acutely toxic and is responsible for liver nec
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd