Define e-ptfe suture material, Biology

Assignment Help:

Define e-PTFE suture material

The e-PTFE suture material is a nonabsorbable monofilament that has high tensile strength, good handling properties, and good knot security, but is expensive compared with all the other nonresorbable suture materials.

 


Related Discussions:- Define e-ptfe suture material

Excretion, what is the composition of urine in fishes and reptiles ?

what is the composition of urine in fishes and reptiles ?

Explain changes in feeding behaviour of infants, Explain Changes in feeding...

Explain Changes in feeding behaviour of infants? On maturation of neuro-muscular system, the body is able to coordinate sucking, swallowing and breathing. Till about three mont

Protozoa, habitat of protozoa .

habitat of protozoa .

Types of lysosomes, TYPE S OF LYSOSOMES (1 )      Primary Lysosomes ...

TYPE S OF LYSOSOMES (1 )      Primary Lysosomes or storage granules or protolysosome - The primary lysosomes are smaller in size, they contain hydrolytic enzyme in the form

Unstable angina, Unstable Angina :  It is indicative of important reversib...

Unstable Angina :  It is indicative of important reversible myocardial ischaernia that needs urgent evaluation and treatment. Medical management usually relieves symptoms and if t

Inotropic agents, All currently available inotropic agents act to increase ...

All currently available inotropic agents act to increase Ca 2+ for activation in both normal and failing myocardium (Hurst). The use of inotropic agents in the treatment of CHF is

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define body building functions of proteins, Define Body Building functions ...

Define Body Building functions of proteins? The primary functions of proteins, as you might be aware, is tissue growth and maintenance. Protein contains amino acids - the build

What is class amphibia , What is Class Amphibia ? Class Amphibia take...

What is Class Amphibia ? Class Amphibia takes its name from the Greek words "amphi" and "bios." Amphi means "both sides," or "both types," and bios means "life." This name-bo

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd