Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Define Distant Osteogenesis?
Distant Osteogenesis : This type of healing has also been described to explain the phenomenon of "Osseointegration" of machined metallic implants. In distance osteogenesis, new bone is formed on the surfaces of old bone in the peri- implant site. The bone surfaces provide a population of osteogenic cells that lay down a new matrix that encroaches on the implant. In this, new bone is not forming on the implant, but the latter does become surrounded by bone and the implant surface will always be partially obscured from bone by intervening cells.
Q. What are few mechanisms by which pathogenic bacteria cause diseases? And why is this knowledge important? Pathogenic bacteria have characteristics called as virulence factor
Determine some Food Sources of chromium? Chromium occurs in trivalent form in foods. Good sources of chromium include whole grains, spices and condiments, meats especially orga
In a comparison of brain found in lower classes of vertebrates to the brain in higher classes of vertebrate's area showing most increase in relative size is: a) Optic lobe b
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is Atrial Switches Operations (Senning or Mustard Operation) ? In transposition of the great arteries there is ventriculo arterial discordance whereby aorta arises from ri
Genes and Alleles The inheritance of any character can be studied only when thcre are two contrasting conditions, such as yellow versus green seed colour (as observed by Mendel
The various types of white blood cells are sometime together referred to as: a) Erythrocytes (pron: eh-rith-row-cites) b) Erythroblasts (pron: eh-rith-rah-blast) c) Leuko
Associated nerves and vessels The Anterior superior alveolar, Infraorbital, and Posterior superior alveolar nerves and arteries provide both the innervation and blood supply to
what is the scientific explanation of "touch me not" plant that can react due to any touch
What is the importance of vitamin A The importance of vitamin A is undisputable. You may already be aware about the functions/role of vitamin A in our body. Vitamin A is absol
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd