Define distant osteogenesis, Biology

Assignment Help:

Q. Define Distant Osteogenesis?

Distant Osteogenesis : This type of healing has also been described to explain the phenomenon of "Osseointegration" of machined metallic implants. In distance osteogenesis, new bone is formed on the surfaces of old bone in the peri- implant site. The bone surfaces provide a population of osteogenic cells that lay down a new matrix that encroaches on the implant. In this, new bone is not forming on the implant, but the latter does become surrounded by bone and the implant surface will always be partially obscured from bone by intervening cells.


Related Discussions:- Define distant osteogenesis

Define nutritional management of food allergies, Define Nutritional Managem...

Define Nutritional Management of Food Allergies and Food Intolerance? The term "hypersensitivity" is general and may include true allergies, reactions that do not affect the im

Osmoregulation in terrestrial environment, Osmoregulation in Terrestrial En...

Osmoregulation in Terrestrial Environment  Earlier you have learnt about osmoregulation in aquatic environment. In this section, we shall study how the terrestrial animals cop

Explain about the pulse vaccination, Explain about the Pulse vaccination? ...

Explain about the Pulse vaccination? How many doses of a given vaccine, administered to what people and on what schedule, permit eradication or control of an infectious disease

Metamorphosis, ME T AMORPHOSIS The differentiation results in the for...

ME T AMORPHOSIS The differentiation results in the formation of larva / infant. The formation of adult from the larva / infant is called as metamorphosis. The metamorph

Symptoms of mitral regurgitation, Q. Symptoms of mitral regurgitation? ...

Q. Symptoms of mitral regurgitation? Symptoms depend upon underlying etiology of mitral regurgitation. Patients with mild mitral regurgitation and most of those with even sever

Post-operative nursing care of cleft palate, Post-operative Nursing Care of...

Post-operative Nursing Care of Cleft Palate  Objective of Care  Provide adequate nutrition  Maintain oral hygiene  Apply restraints  Promote speech  Give

Define prevention of idd - double fortified salt, Define prevention of idd ...

Define prevention of idd - Double Fortified salt? iron deficiency anaemia and iodine deficiency disorders often co-exist, the most effective approach to control these public he

Explain electron microscope, Explain Electron Microscope? Electron micr...

Explain Electron Microscope? Electron microscopes have higher magnification and resolving power than light microscopes.  What do we mean by magnification and resolving power? W

Enzyme, Starch is a large molecule consisting of between 300 to 500 glucose...

Starch is a large molecule consisting of between 300 to 500 glucose molecules joined together.  A glucose molecule is only very small, consisting of 24 atoms.  Cellophane is simila

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd