Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define Citrate Utilization Test - imvic test?
Several microorganisms have the ability to make use of citrate as the sole source of carbon and energy. This ability relies on the presence of citrate permease and citrase in the organism. Citrate permease makes easy the transport of citrate in the cell while citrase acts on citrate to produce oxaloacetic acid and acetate as pointed out in the reaction.
Citrate utilization through microorganisms can be detected by using Simmons citrate medium that consists of sodium citrate as the sole carbon source and bromothymol blue like pH indicator. When citrate in the medium is utilized by microorganisms, resulting CO2 reacts with sodium and water to form sodium carbonate. This alterations the pH of the medium to alkaline and its colour from green to deep prussian blue. Bromothymol blue is green while acidic (pH 6.8 and below) and blue while alkaline (pH 7.6 and higher).
Biological Stress Since in nature, the various organisms do not live in complete isolation from others, stress to a plant species might also be caused by what other organisms
Define Prevalence of Weight Management? WHO (1998) estimates that in developing countries about 245 million adults are moderately underweight and 93 million severely underweigh
Explain Adverse Effects of Caspofungin Although generally well tolerated, caspofungin occasionally causes rash, fever and mild hepatic toxicity (Medical Letter 2001; 43:58). An
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Briefly explain about the Sit-ups Test? To measure muscular endurance, bent knee sit-ups can be done. Sit-ups begin with the subject lying flat on their backs with their knees
Clinical Manifestations Can be chronic to acute, mild to severe. Acute attack often occur at night. During an acute attack, audible inspiratory and expiratory wheezing. Patie
Synthesis of citratefrom acetyl CoA and oxaloacetate: Citrate synthase catalyses this aldol condensation reaction with the release of CoA. There are certain inhibitors to this re
Explain Systematic - Modern Trends in Animal Taxonomy Systematic is defined as the study of relationship among organisms which means reconstruction of phylogenies. It is that b
What is an endospore? An endospore is a specialized, highly resistant, dormant structure formed within the vegetative cell of some bacteria e.g. Bacillus (rod), Clostridium (ro
Q. What are the factors which influence the spoilage of meat? Can you list a few? Ans. Sure enough, you should be able to enumerate these having learnt about them earlier
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd