Define citrate utilization test - imvic test, Biology

Assignment Help:

Define Citrate Utilization Test - imvic test?

Several microorganisms have the ability to make use of citrate as the sole source of carbon and energy. This ability relies on the presence of citrate permease and citrase in the organism. Citrate permease makes easy the transport of citrate in the cell while citrase acts on citrate to produce oxaloacetic acid and acetate as pointed out in the reaction.

Citrate utilization through microorganisms can be detected by using Simmons citrate medium that consists of sodium citrate as the sole carbon source and bromothymol blue like pH indicator. When citrate in the medium is utilized by microorganisms, resulting CO2 reacts with sodium and water to form sodium carbonate. This alterations the pH of the medium to alkaline and its colour from green to deep prussian blue. Bromothymol blue is green while acidic (pH 6.8 and below) and blue while alkaline (pH 7.6 and higher). 


Related Discussions:- Define citrate utilization test - imvic test

Biological stress, Biological Stress Since in nature, the various orga...

Biological Stress Since in nature, the various organisms do not live in complete isolation from others, stress to a plant species might also be caused by what other organisms

Define prevalence of weight management, Define Prevalence of Weight Managem...

Define Prevalence of Weight Management? WHO (1998) estimates that in developing countries about 245 million adults are moderately underweight and 93 million severely underweigh

Explain adverse effects of caspofungin, Explain Adverse Effects of Caspofun...

Explain Adverse Effects of Caspofungin Although generally well tolerated, caspofungin occasionally causes rash, fever and mild hepatic toxicity (Medical Letter 2001; 43:58). An

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Briefly explain about the sit-ups test, Briefly explain about the Sit-ups T...

Briefly explain about the Sit-ups Test? To measure muscular endurance, bent knee sit-ups can be done. Sit-ups begin with the subject lying flat on their backs with their knees

Clinical manifestations of bronchial asthma, Clinical Manifestations C...

Clinical Manifestations Can be chronic to acute, mild to severe. Acute attack often occur at night. During an acute attack, audible inspiratory and expiratory wheezing. Patie

Synthesis of citratefrom acetyl coa and oxaloacetate, Synthesis of citratef...

Synthesis of citratefrom acetyl CoA and oxaloacetate: Citrate synthase catalyses this aldol condensation reaction with the release of CoA. There are certain inhibitors to  this re

Explain systematic - modern trends in animal taxonomy, Explain Systematic -...

Explain Systematic - Modern Trends in Animal Taxonomy Systematic is defined as the study of relationship among organisms which means reconstruction of phylogenies. It is that b

What is an endospore - staining strategies, What is an endospore? An en...

What is an endospore? An endospore is a specialized, highly resistant, dormant structure formed within the vegetative cell of some bacteria e.g. Bacillus (rod), Clostridium (ro

What are the factors which influence the spoilage of meat, Q. What are the ...

Q. What are the factors which influence the spoilage of meat? Can you list a few? Ans. Sure enough, you should be able to enumerate these having learnt about them earlier

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd