Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Cell plate: In the plants, a membrane-bound space produced during the process of cytokinesis by the vesicles of the Golgi apparatus. The cell plate fuses with plasma membrane, separating the cell into two compartments.
Define the Qualitative Technique in Nutritional Biochemistry? In this manual you will be familiarized with simple qualitative techniques and tests to identify compounds such as
Q. Preparation of the Laboratory Samples From the primary sample while selecting a representative laboratory sample, we need to consider the following: a) Laboratory sampl
How can the hypothesis that asserts that chloroplasts as well as mitochondria were primitive prokaryotes that associated in mutualism with primitive anaerobic eukaryotic cells be c
Define Plate Counts and Colony Forming Unit? Plate counts is the most frequently used method to measure microbial numbers. The technique, however, can be used only for those mi
Oxygen - Factors Influencing Functions of Nitrogenase Oxygen is a strong inhibitor of N 2 -fixation because it blocks both the synthesis as well as the activity of nitrogenase
Exercise Stress or emotional upset Medications Aspirin, non-steroidal anti-inflammatory drugs(NSAIDs), beta- blockers(including eye drops), cholinergic dr
nervous system of vertebrates
Define Requirements and Recommended Dietary Allowances (RDA)? What do we mean by requirements and RDA? The requirement level is the amount of nutrient needed to be absorbed to
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Autogenic and Allogenic Succession In many cases the living beings of an ecosystem, modify their environment considerably by their growth, death and decay. The changed condit
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd