Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define briefly about the Selenium?
The element selenium was discovered in 1817 in association with the element sulphur. However, selenium as an essential nutrient remained unrecognized for many years, although selenium toxicity in horses and cattle, "blind staggers" and "alkali disease" was known since the 1930s. The first description of the dietary selenium deficiency in isolated populations in the People's Republic of China, was made in 1979. The disease known as Keshan disease, named for the country where it was first recognized, was characterized by cardiomyopathy affecting primarily children and young women. The disease was often fatal. The second selenium deficiency disease Kashin-Beck disease was reported in 1980. It was prevalent in China and Sino-Soviet border. Both the diseases were caused primarily due to selenium deficiency in the soil.
Selenium is a non metallic element and exists in several oxidation states which include Se2+, Se4+ and Se6+. The chemistry of selenium is similar to that of sulphur. Selenium replaces sulphur to form organic compounds such as selenocysteine and selenomethionine. Total selenium content of the body varies from 3-15 mg depending on the dietary intake. Approximately 30% of tissue selenium is contained in the liver, 15% in kidney, 30% in muscle and 10% in blood plasma. Much of tissue selenium is found in proteins as selenoanalogues of sulphur amino acids; other metabolically active forms include selenotrisulphides and other acid-labile selenium compounds.
Define Transport and Storage of Iron? You have seen that transferrin binds both newly absorbed iron and iron released after degradation of haemoglobin. Transferrin is a glycopr
Diarrhoeas disease: Diarrhoeas disease rank among th most leading causes of children's death in developing countries. We shall discuss two main problems in this section i.e.
What is the role of heart in human body? The heart is the main pump that circulates the blood and fluid within the body. The heart, beats at 72 times per minute, and pumps abou
State about osteogenesis Embryologically, osteogenesis may be classified as either intramembranous or endochondral. When the ossification occurs directly, it is defined as intr
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
What is Cytogenetics? Before the advent of modern technology, the American biologists Thomas Hunt Morgan, G.W. Beadle, H. Sturtevant, Barbara McClintock, and others contributed
Illustrate oil-bearing materials Oil contents for vegetable oil-bearing materials vary between 18% and 68% of the total weight of the seed, nut, kernel or fruit as indicated i
Q. What are the three phases into which the HIV infection is often divided? The HIV infection is frequently divided into three phases the acute phase, from the infection to 1 u
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Which is the kind of muscle tissue that moves the bones? The bones are moved by the skeletal striated muscles these muscles are voluntary (controlled by volition).
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd