Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define Brain Stem
Brain stem consists of three parts i.e. midbrain, pons and medulla oblongata.
The functions of the Brain Stem are:
Brain stem contains points of cranial nerve origin.
Midbrain and pons convey impulses and control movement of eyes, head.
Medulla Oblongata connects brain with spinal cord.
Process of Regeneration in Planarians Regeneration in planarians has been broadly studied and considerable information regarding this phenomenon is now available. Let us see w
Q. How are nutrients distributed through the digestive system in planarias? Planarias have single opening digestive system incomplete with ramifications that transport nutrient
Detecting and resolving discrepancies: Since the information selected to enter consciousness is usually about changes in the external and internal worlds, when there is a discrepan
Explain the Determination of Hydrolysis Hydrolysis of calcium pantothenate in acidic medium produces α,γ-dihydroxy-β,β-dimethylbutyrolactone, which reacts with hydroxylamine i
How body fat can be measured? The conventional golden method of measuring BF% is by underwater weighing. Difference of weight in air and in water gives density, from which the
Zanamivir (Relenza) Started within 2 days after onset of symptoms, this orally inhaled neuraminidase inhibitor can shorten the duration of illness and may decrease the incide
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
In a neuron at rest, the membrane A. voltage will be less than zero. B. sodium conductance is greater than the membrane potassium conductance. C. voltage is less than the
Q. Describe the Morphological Characteristics? One of the first steps in the identification of bacteria in food is microscopic examination to ascertain the shape, size, aggreg
Q. What is trichomoniasis? Why is it classified as an STD? The Trichomoniasis is an extra-intestinal protozoan infection caused by the Trichomonas vaginalis, a flagellate proto
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd