Define brain stem, Biology

Assignment Help:

Define Brain Stem

Brain stem consists of three parts i.e. midbrain, pons and medulla oblongata.

The functions of the Brain Stem are:

Brain stem contains points of cranial nerve origin.

Midbrain and pons convey impulses and control movement of eyes, head.

Medulla Oblongata connects brain with spinal cord.

 


Related Discussions:- Define brain stem

Process of regeneration in planarians, Process of Regeneration in Planarian...

Process of Regeneration in Planarians Regeneration in planarians has been broadly studied and considerable information regarding this phenomenon is now available. Let us see w

Digestive system in planarias, Q. How are nutrients distributed through the...

Q. How are nutrients distributed through the digestive system in planarias? Planarias have single opening digestive system incomplete with ramifications that transport nutrient

Detecting and resolving discrepancies, Detecting and resolving discrepancie...

Detecting and resolving discrepancies: Since the information selected to enter consciousness is usually about changes in the external and internal worlds, when there is a discrepan

Explain the determination of hydrolysis, Explain the Determination of Hydro...

Explain the Determination of Hydrolysis Hydrolysis of calcium pantothenate in acidic medium produces  α,γ-dihydroxy-β,β-dimethylbutyrolactone, which reacts with hydroxylamine i

How body fat can be measured, How body fat can be measured? The convent...

How body fat can be measured? The conventional golden method of measuring BF% is by underwater weighing. Difference of weight in air and in water gives density, from which the

Explain zanamivir, Zanamivir  (Relenza) Started within 2 days after on...

Zanamivir  (Relenza) Started within 2 days after onset of symptoms, this orally inhaled neuraminidase inhibitor can shorten the duration of illness and may decrease the incide

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the potassium conductance, In a neuron at rest, the membrane A....

In a neuron at rest, the membrane A. voltage will be less than zero. B. sodium conductance is greater than the membrane potassium conductance. C. voltage is less than the

Describe the morphological characteristics, Q. Describe the Morphological C...

Q. Describe the Morphological Characteristics? One of the first steps in the identification of bacteria in food is microscopic examination to ascertain the shape, size, aggreg

What do you mean by trichomoniasis, Q. What is trichomoniasis? Why is it cl...

Q. What is trichomoniasis? Why is it classified as an STD? The Trichomoniasis is an extra-intestinal protozoan infection caused by the Trichomonas vaginalis, a flagellate proto

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd