Define basic function of secretin in the digestive process, Biology

Assignment Help:

Q. Where is it produced and what is the function of secretin in the digestive process?

Secretin is made in the duodenum the chyme acidity causes the duodenum to release this hormone that in its turn stimulates the secretion of the pancreatic  juice.


Related Discussions:- Define basic function of secretin in the digestive process

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What are the apical meristems, What are the apical meristems? Which kind of...

What are the apical meristems? Which kind of plant growth does this meristem promote? The Apical meristems are those primary meristems found in the apex of the stem as well as

Determine the uses of iron - soil, Determine the uses of Iron - Soil Ir...

Determine the uses of Iron - Soil Iron is a constituent of cytochromes, haem and non-haem enzymes. It is also essential for chlorophyll formation though is not a part of it. It

Quantitative or analytical method for estimation of nitrogen, Define Quanti...

Define Quantitative or Analytical Method for Estimation of Nitrogen and Protein? You may recall reading earlier that proteins contain nitrogen along with carbon, hydrogen and s

How lysosomal enzymes involved in the scavenging of aged, How Lysosomal enz...

How Lysosomal enzymes involved in the scavenging of aged Lysosomal enzymes are also involved in the scavenging of aged and damaged cells. In several diseased states and also by

What is the probability that the child will have pku, PKU is a recessive di...

PKU is a recessive disorder. Suppose two people who were heterozygous for PKU married and had a child. What is the probability that the child will have PKU?

Conservation of animal genetic resources, The term farm animal genetic reso...

The term farm animal genetic resources (AnGR) is used to include all animal species, breeds and strains (and their wild relatives) that are of economic, scientific and cultural int

What do you mean by amphibians of the plant world, Q. Why can the bryophyte...

Q. Why can the bryophytes be considered the "amphibians of the plant world"? Like adult amphibians, the bryophytes live in the terrestrial environment but they depend on water

Standardization of copper sulphate solution, It involves the standardizatio...

It involves the standardization of copper sulphate solution. This is same as done in the previous activity. 1)  Pipette accurately 5 ml of Solution A and Solution B in conical f

How are antivenoms produced, Q. How are antivenoms produced? Why are antive...

Q. How are antivenoms produced? Why are antivenoms an example of passive immunization? Antivenoms are obtained by the following process: the venom (antigen) is inoculated into

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd