Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define Amino acid requirements for Human?
Data regarding the essential amino acid requirements of infants, children and adults are given in terms of egg protein and cow's milk protein (g/kg/day) required to meet the amino acid needs. These requirements are given in the Table
Table: Essential amino acid requirements
The Committee suggested a Reference Amino Acid Pattern in 1973. Since adequate experimental evidence for the suitability of the pattern was not available, the Committee adopted egg and milk proteins as reference proteins and expressed protein requirements in terms of egg or milk proteins. The Committee assumed that the proteins of milk or eggs are utilized to the same extent in children and gave a protein score of 100 to egg and milk proteins.
Determine the Signs and Symptoms of Bulimia? 1. Binges, minimum twice a week for three months 2. Purging a Menstrual irregularities 3. Swollen glands Frequent fluct
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Give the biological effects of aflatoxin and List the various natural toxins present in food? Biological effects of aflatoxin include hepatotoxicosis, carcinogenesis and liv
Empiric Initial Therapy Until susceptibility results are available, empiric initial treatment consists of a 4-drug regimen of isoniazid, rifampin, pyrazinamide and ethambutol.
Blood from the fetus circulates through the placenta. a) What substances pass (i) from the maternal to the fetal blood, (ii) from the fetal to the maternal blood?
BIOLOGY - A SCIENCE OF EXCEPTION - Some common examples to prove it are - 1. Embryos of dicot plants have 2 cotyledons but in cuscuta (Dodder plant or amer bel or Aka
Homo neanderthalensis successfully lived in the cold, harsh ice-age conditions of Europe until becoming extinct approximately 30 000 years ago. Adaptations which enabled them to s
List three important discoveries that resulted from the Human Genome Project. Answers should contain three of the following: Only about 2 percent of the human genome encodes p
Implementation of Nursing Care Provide Bed Rest and Comfort Your major role as a nurse is to provide bed rest to the child and assist the child and parents to understa
There are three levels of diversity viz. genetic, species and ecosystem diversity. In effect, these levels cannot be separated. Each is important, interacting with a nd influencin
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd