Define advantages of using yeast as a source of protein, Biology

Assignment Help:

Define Advantages of using Yeast as a source of Protein?

1. Large size, hence separation from the culture medium is easy.

2. As the pH of the growth is towards acidic side, high amount of lysine is produced in the proteins, hence protein is more acceptable and of higher biological value.


Related Discussions:- Define advantages of using yeast as a source of protein

Discuss in brief about human nose, Nose Nose consists of external and i...

Nose Nose consists of external and internal parts. The inner lining of the nose contains millions of small receptors. These receptors are located on the sensory hairs.

Facilitation model - models of succession, Facilitation Model - Models of S...

Facilitation Model - Models of Succession This is considered as the classical model of succession. It is based on the assumption that species of a previous stage are replaced

How much dopamine do need add from a stock, A cat has just arrived to the v...

A cat has just arrived to the veterinary clinic with low blood pressure. The cat weighs 5 kg, and as the on call Vet you want to use a bag of saline to prepare a dopamine drip for

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Genetic, 1. The genes for ruby eyes (rb), tan body (t) and cut wings (ct) a...

1. The genes for ruby eyes (rb), tan body (t) and cut wings (ct) are all found on the X-chromosome of Drosophila melanogaster. All of these are recessive traits. They map in the or

Discovery of the cell, Q. Describe the Discovery of the Cell? Ans: The ...

Q. Describe the Discovery of the Cell? Ans: The discovery that living organisms are composed of cells was made by an Englishman, Robert Hooke, in 1665. Hooke used the light mic

What is ancylostomiasis, What is ancylostomiasis? Ancylostomiasis is a ...

What is ancylostomiasis? Ancylostomiasis is a disease caused by Ancylostoma duodenale or Necator americanus, both hookworms belonging to the nematode phylum (roundworms). Ancyl

Explain the characteristics of starch granule, Explain the Characteristics ...

Explain the Characteristics of Starch Granule Starch granules, primarily, are made up of amylose (20-30%) and or amylopectin (70-80%) molecules arranged radially. Each granule

Avian tuberculosis, Avian tuberculosis The infection in poultry usuall...

Avian tuberculosis The infection in poultry usually occurs from ingestion of contaminated food and water. The lesions develop in spleen, liver and intestines; less frequently

Eye muscles, MUSCLES - In eye orbit, eye ball is fixed by 6 skeletal...

MUSCLES - In eye orbit, eye ball is fixed by 6 skeletal muscles attached to 3rd, 4th & 6th cranial nerves (motor). 4 - straight or recti muscles are present. 2 - oblique

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd