Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define Advantages of using Yeast as a source of Protein?
1. Large size, hence separation from the culture medium is easy.
2. As the pH of the growth is towards acidic side, high amount of lysine is produced in the proteins, hence protein is more acceptable and of higher biological value.
Nose Nose consists of external and internal parts. The inner lining of the nose contains millions of small receptors. These receptors are located on the sensory hairs.
Facilitation Model - Models of Succession This is considered as the classical model of succession. It is based on the assumption that species of a previous stage are replaced
A cat has just arrived to the veterinary clinic with low blood pressure. The cat weighs 5 kg, and as the on call Vet you want to use a bag of saline to prepare a dopamine drip for
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
1. The genes for ruby eyes (rb), tan body (t) and cut wings (ct) are all found on the X-chromosome of Drosophila melanogaster. All of these are recessive traits. They map in the or
Q. Describe the Discovery of the Cell? Ans: The discovery that living organisms are composed of cells was made by an Englishman, Robert Hooke, in 1665. Hooke used the light mic
What is ancylostomiasis? Ancylostomiasis is a disease caused by Ancylostoma duodenale or Necator americanus, both hookworms belonging to the nematode phylum (roundworms). Ancyl
Explain the Characteristics of Starch Granule Starch granules, primarily, are made up of amylose (20-30%) and or amylopectin (70-80%) molecules arranged radially. Each granule
Avian tuberculosis The infection in poultry usually occurs from ingestion of contaminated food and water. The lesions develop in spleen, liver and intestines; less frequently
MUSCLES - In eye orbit, eye ball is fixed by 6 skeletal muscles attached to 3rd, 4th & 6th cranial nerves (motor). 4 - straight or recti muscles are present. 2 - oblique
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd