Define about the carbohydrates, Biology

Assignment Help:

Define about the Carbohydrates?

In the previous unit, we came to know that availability of glucose is the major factor in exercise performance. Hence, carbohydrate manipulation is generally done by either increasing glycogen stores before the event or by consuming carbohydrates during the event. Few days before the event, generally carbohydrate loading procedure is adopted by the athletes but this procedure is recommended only for events lasting more than 90 min or repetitive events occurring in single or multiple days. Events like sprinting, runs 10 km, weight lifting, hockey games etc. have lesser benefits of carbohydrate loading. When an event lasts more than one hour, an athlete may benefit from consuming carbohydrates during exercise. Drinks, such as diluted fruit juices or sports drinks, which contain less than 24 g of carbohydrate per cup, may be the best form for this. It is important to eat a high carbohydrate snack after an exercise session to replace muscle glycogen stores.


Related Discussions:- Define about the carbohydrates

Name which part of the seed in other monocotyledons, The scutellum observed...

The scutellum observed in a grain of wheat or maize is comparable to which part of the seed in other monocotyledons? 1. Cotyledon 2. Endosperm 3. Aleurone layer 4. Plum

Symptoms of enteropathogenic escherichia coli, Symptoms: The E. coli gastro...

Symptoms: The E. coli gastroenteritis syndrome is caused by the ingestion of 10 6 -10 10 viable cells/g that must colonize the small intestine and produce  enterotoxin. The syndr

Identification and care of taxonomic collections, Q. Identification and Car...

Q. Identification and Care of Taxonomic collections? Collection of plant specimens is essential for taxconomic research. Herbarium specimens become a permanent record. Select t

Flagellates - parasitic protozoan, Flagellates - Parasitic Protozoan S...

Flagellates - Parasitic Protozoan Several flagellate protozoa parasitise man and live in the blood stream or tissues of the reticulo-endothelial system. Most significant of th

What are the major novelties presented by fishes, Q. What are the major fea...

Q. What are the major features of fishes associated to the habitat where they live? Fishes are all aquatic animals and thus they have a hydrodynamic elongated body appropriate

Cholesterol question, If an infant had a cholesterol level of 800 you may s...

If an infant had a cholesterol level of 800 you may suspect (blank)? How could this happen?d

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Determine the statement- the evolution of color vision, Based on your readi...

Based on your reading of the article entitled "The Evolution of Color Vision", which of the following is a false statement? A. Trichomatic vision is found in all male and femal

What is the food processing, What is the Food Processing? Food processi...

What is the Food Processing? Food processing, as you learnt earlier, involves the conversion of raw materials and ingredients into an acceptable food product for the consumer.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd