Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define about the Carbohydrates?
In the previous unit, we came to know that availability of glucose is the major factor in exercise performance. Hence, carbohydrate manipulation is generally done by either increasing glycogen stores before the event or by consuming carbohydrates during the event. Few days before the event, generally carbohydrate loading procedure is adopted by the athletes but this procedure is recommended only for events lasting more than 90 min or repetitive events occurring in single or multiple days. Events like sprinting, runs 10 km, weight lifting, hockey games etc. have lesser benefits of carbohydrate loading. When an event lasts more than one hour, an athlete may benefit from consuming carbohydrates during exercise. Drinks, such as diluted fruit juices or sports drinks, which contain less than 24 g of carbohydrate per cup, may be the best form for this. It is important to eat a high carbohydrate snack after an exercise session to replace muscle glycogen stores.
The scutellum observed in a grain of wheat or maize is comparable to which part of the seed in other monocotyledons? 1. Cotyledon 2. Endosperm 3. Aleurone layer 4. Plum
Symptoms: The E. coli gastroenteritis syndrome is caused by the ingestion of 10 6 -10 10 viable cells/g that must colonize the small intestine and produce enterotoxin. The syndr
Q. Identification and Care of Taxonomic collections? Collection of plant specimens is essential for taxconomic research. Herbarium specimens become a permanent record. Select t
Flagellates - Parasitic Protozoan Several flagellate protozoa parasitise man and live in the blood stream or tissues of the reticulo-endothelial system. Most significant of th
Q. What are the major features of fishes associated to the habitat where they live? Fishes are all aquatic animals and thus they have a hydrodynamic elongated body appropriate
WHAT ARE THE DEMERITS OF CONTINOUS BREEDERS
If an infant had a cholesterol level of 800 you may suspect (blank)? How could this happen?d
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Based on your reading of the article entitled "The Evolution of Color Vision", which of the following is a false statement? A. Trichomatic vision is found in all male and femal
What is the Food Processing? Food processing, as you learnt earlier, involves the conversion of raw materials and ingredients into an acceptable food product for the consumer.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd