Deficiency diseases-metabolic disorders, Biology

Assignment Help:

Metabolic Disorders


The disease conditions, which are attributable to an imbalance between rates of input of dietary nutrients and the output of production, are defined as production diseases. These conditions, previously known as metabolic diseases, occur more commonly and assume greatest importance in dairy cows and buffaloes, and pregnant ewes. Parturient paresis (milk fever), ketosis (acetonaemia), downers cow syndrome, lactation tetany of mares, hypomagnesaemic tetanies, pregnancy toxaemia in sheep, fat cow syndrome and post-parturient haemoglobinuria in cattle and buffaloes are commonly encountered production diseases.


Production or metabolic diseases may be predisposed by the genetic factors. However, they are associated largely to production and management factors. In most  cases increased demand for a specific nutrient that has become deficient under certain conditions is the primary cause of development of production diseases. High yielding dairy cows and buffaloes generally verge on abnormal homeostasis, and their feeding and management for enhanced milk production make them more susceptible to metabolic diseases.


Related Discussions:- Deficiency diseases-metabolic disorders

Can the heat capacity of water be considered small or large, Can the heat c...

Can the heat capacity of water be considered small or large? What is the biological significance of that characteristic? From thermology it is called that the quantity of exch

#title. Principles of Biology, Does greater light 80 cm instead of 20 cm p...

Does greater light 80 cm instead of 20 cm produce more photosynthesis on plants? Why or why not

Effects on weather - air pollutants, Effects on Weather - Air pollutants ...

Effects on Weather - Air pollutants Dust, smoke and other suspended particulate matter reduce visibility. Fly-ash also affects visibility by intercepting and scattering solar

Hardy - weinberg law, HARD Y - WEINBERG LAW - Proposed by G.H. Hard...

HARD Y - WEINBERG LAW - Proposed by G.H. Hardy and W. Weinberg in 1908 independently. The law states "the frequency of genes or alleles in a population remains constant

Explain the alterations occurring in meat and poultry, Alterations occurrin...

Alterations occurring in meat and poultry Meat, as you already know, is  rich in proteins and contains most of the essential amino acids.  It is also rich in minerals such as c

Excretion., organisms and their excretory organelles

organisms and their excretory organelles

Phylum , General characteristics of phylum

General characteristics of phylum

smog - london smog and photochemical smog, The word 'smog' consists of two...

The word 'smog' consists of two words 'smoke' and 'fog'. This name was given because Fog in the atmosphere Condense on the carbon particles of smoke to form smog. There are two typ

Which glands secrete their product into circulatory system, Name of the duc...

Name of the ductless glands that secrete their product into the circulatory system are: a) Exocrine (pron: ek-seh-kren) b) Apocrine (pron: ap-eh-kren) c) Holocrine (pron:

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd