Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Plankton - Aquatic Ecosystem This group includes both microscopic plants (phytoplankton) and animals (zooplankton) found in all aquatic ecosystems, except certain swift moving
Determine the term - essential element It becomes difficult to meet all the conditions so as to establish essentiality. This is particularly so for the elements that are requir
Q. What are the main manifestations of leishmaniasis? There are two key forms of leishmaniasis: visceral leishmaniasis and cutaneous leishmaniasis (also known as kala-azar). Th
Explain about the Serengeti Ecosystem? The Serengeti ecosystem, one of the most stunning biological communities in the world, was devastated by the introduction of rinderpest f
There may also be non-use existence values for components of biological diversity due to the value placed on biodiversity purely based on its continued existence, irrespective of w
Q. Show the process of Construction of Keys? Keys are constructed using contrasting characters. The possible names in the key are divided into smaller and smaller groups. Each
Define Shell Fish as a rich source of protein? Information on shellfish is fragmentary and incomplete. In shell fish, the shell comprises of a large portion of live weight of t
Polysaccharide - polymer composed of monosaccharide monomers Starch - Energy storage in plants à straight (amylose) and branched (amylopectin) chains of α-glucose Glycogen
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define Affluence and abundant availability of food as factor for obesity? With increasing affluence, increase in purchasing power and abundance of food, people tend to eat more
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd