Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Cytokinesis
It is defined as the division or cleavage of cytoplasmic part of the cells into two daughter cells. It is first indicated during late anaphase by appearance of an annular, indentation or cleavage furrow upon cell surface at the level of equatorial plane of spindle ( same as previously occupied by metaphase plate.) The furrow progress ively deepens like a contractile ring and ultimately splits the cells into daughter cells at about the end of telohase. Cytoplasmic microfilaments , including those of myosin and actin appear to be involved information of the furrow and its progressive contraction . plants cells do not divide by furrowing , but by formation of a cells plate in the plane of meta phase plate,
Before final cell cleavage, the main cytoplasmic organelles , except golgi complex, segregate in polar regions of the parent cells so that they may be almost equally distribution to the resultant daughter cells.
Which of the below are skin receptors in humans which are sensitive to heat? Are they: a) End organs of Krause b) Meissner's corpuscles c) End organs of Ruffini d)
what happens to your total peripheral resistance when you go from a warm room to cool outside air
what is the prevailing wind direction in equatorial regions affected by the trade winds? a) The wind blows from east to west b) the wind blows from west to east
Q. Why is the nickname "dark reactions" not completely correct for the chemical stage of photosynthesis? "Dark reactions" is not a correct name for the chemical phase of photos
Following statement true for prokaryotic or eukaryotic? They use deoxyribonucleic acid as their major information storage molecule
What are Proteins and Why they are important for us? We just read that proteins are essential for maintaining and sustaining life. What are proteins or what constitutes protein
Define the Food Processing? We are all aware that delay in the use of fresh foods, alters its freshness, palatability and nutritive value. Therefore, it becomes very important
Soybean protein isolates: Soy protein isolates are the most pure and refined soy protein available. Isolated soybean proteins (ISP), or soybean protein isolates, are the mos
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What are the consequences of shifting the chemical equilibrium of the formation of bicarbonate from carbon dioxide and water towards the increase of product (bicarbonate) format
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd