Cytokinesis, Biology

Assignment Help:

Cytokinesis

It is defined  as the division or cleavage  of cytoplasmic  part   of the cells  into  two  daughter  cells. It is first  indicated   during  late  anaphase  by appearance  of an  annular,  indentation  or cleavage furrow upon  cell surface  at  the level  of equatorial  plane  of  spindle  ( same as previously occupied  by metaphase plate.) The  furrow  progress  ively deepens like    a contractile ring  and ultimately splits the  cells into daughter cells  at about  the end  of telohase. Cytoplasmic  microfilaments , including  those of  myosin  and actin   appear to  be involved information   of  the furrow  and  its progressive  contraction . plants  cells  do not  divide  by furrowing  , but  by formation  of a cells   plate  in the plane of meta phase plate,

Before  final cell cleavage, the  main  cytoplasmic   organelles , except  golgi  complex, segregate in polar regions of the  parent cells  so that  they may  be almost  equally distribution to the resultant daughter  cells.


Related Discussions:- Cytokinesis

Name the skin receptors in humans, Which of the below are skin receptors...

Which of the below are skin receptors in humans which are sensitive to heat? Are they: a) End organs of Krause b) Meissner's corpuscles c) End organs of Ruffini d)

Physiology, what happens to your total peripheral resistance when you go fr...

what happens to your total peripheral resistance when you go from a warm room to cool outside air

What is the prevailing wind direction, what is the prevailing wind directio...

what is the prevailing wind direction in equatorial regions affected by the trade winds? a) The wind blows from east to west b) the wind blows from west to east

Illustrate dark reactions, Q. Why is the nickname "dark reactions" not comp...

Q. Why is the nickname "dark reactions" not completely correct for the chemical stage of photosynthesis? "Dark reactions" is not a correct name for the chemical phase of photos

Following statement true for prokaryotic or eukaryotic, Following statement...

Following statement true for prokaryotic or eukaryotic? They use deoxyribonucleic acid as their major information storage molecule

What are proteins and why they are important for us, What are Proteins and ...

What are Proteins and Why they are important for us? We just read that proteins are essential for maintaining and sustaining life. What are proteins or what constitutes protein

Define the food processing, Define the Food Processing? We are all awar...

Define the Food Processing? We are all aware that delay in the use of fresh foods, alters its freshness, palatability and nutritive value. Therefore, it becomes very important

Explain soybean protein isolates, Soybean protein isolates:  Soy protei...

Soybean protein isolates:  Soy protein isolates are the most pure and refined soy protein available.  Isolated soybean proteins (ISP), or  soybean protein isolates, are the mos

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Consequences of shifting the chemical equilibrium, Q. What are the conseque...

Q. What are the consequences of shifting the chemical equilibrium of the formation of bicarbonate from carbon dioxide and water towards the increase of product (bicarbonate) format

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd